Difference between revisions of "Part:BBa K4768006"
 
(9 intermediate revisions by 2 users not shown)
Line 20: Line 20:
 
<html>
 
<html>
  
−
<h2>Introduction
+
<h2>Introduction</h2>
 +
 
 
<div align="center">
 
<div align="center">
 
         <figure class="normal mx-auto">     
 
         <figure class="normal mx-auto">     
Line 31: Line 32:
 
</div>
 
</div>
  
−
<p>The CALIPSO part BBa_K4768005 is composed of the N-terminal subunit of the T7 RNA polymerase (residues 1 to 180) fused to the anti-HER2 antibody Pertuzumab through a soluble linker. This gene is under transcriptional control of an SP6 promoter and T7 terminator.</p>
 
  
−
<p>This part, coupled to the part BBa_K4768005 containing the N-terminal subunit of the T7 RNA polymerase, has been designed to develop a split T7 RNAP-based biosensor capable of recognizing HER-2, an epidermal growth factor that is overexpressed in cancer cells [1], in solution.</p>
+
<p>The CALIPSO part BBa_K4768006 is composed of the anti-HER2 antibody Trastuzumab fused to the C-terminal subunit of the T7 RNA polymerase (residues 181 to 704)  through a soluble linker. This gene is under transcriptional control of an SP6 promoter and T7 terminator. </p>
 +
 
 +
<p>This part, coupled to the part <a href="https://parts.igem.org/Part:BBa_K4768005" target="blank">BBa_K4768005</a> containing the N-terminal subunit of the T7 RNA polymerase, has been designed to develop a split T7 RNAP-based biosensor capable of recognizing HER2, an epidermal growth factor that is overexpressed in cancer cells [1], in solution.
  
−
<p>The HER2-induced T7 RNAP complex was designed from two existing constructs: a split T7 RNAP-based biosensor for the detection of rapamycin[2] and a split luciferase conjugated with antibodies capable of recognizing HER2. We decided to merge the relevant functionalities of these two constructs and created a new biosensor that transduces HER2 binding to gene expression activation. </p>
+
<p>The HER2-induced T7 RNAP complex was designed from two existing constructs: a split T7 RNAP-based biosensor for the detection of rapamycin [2] and a split luciferase conjugated with antibodies capable of recognizing HER2 [3]. We decided to merge the relevant functionalities of these two constructs and created a new biosensor that transduces HER2 binding to gene expression activation. </p>
  
 
<div align="center">
 
<div align="center">
Line 48: Line 50:
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>The CALIPSO part BBa_K4768006 consists in the C-terminal subunit of the T7 RNA polymerase fused to trastuzumab, an anti-HER2 antibody, on his C-terminal domain through an 8-amino-acid-long linker of glycines and serines. The synthesis of this gBlock was made by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.</p>
+
<p>The CALIPSO part BBa_K4768006 consists in the C-terminal subunit of the T7 RNA polymerase fused to Trastuzumab, an anti-HER2 antibody, on its C-terminal domain through an 8-amino-acid linker of glycine and serine residues. The synthesis of this gBlock was made by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.</p>
  
  
Line 63: Line 65:
 
             style="width:70%;"
 
             style="width:70%;"
 
             src="https://static.igem.wiki/teams/4768/wiki/registry/gfp-part/trastu-prc-screening.png">  
 
             src="https://static.igem.wiki/teams/4768/wiki/registry/gfp-part/trastu-prc-screening.png">  
−
             <figcaption class="normal"><span class="titre-image"><i><b>Figure 3</b>One of the Agarose Gel Electrophoresis Results for PCR Screening on Plasmid Extracts from 24 Clones.</i></span></figcaption>
+
             <figcaption class="normal"><span class="titre-image"><i><b>Figure 3: Agarose gel electrophoresis or PCR screening on plasmids extracted from 24 clones.</b></i></span></figcaption>
 
         </figure>
 
         </figure>
 
</div>
 
</div>
  
−
<p>24 transformants were screened by colony PCR with primers flanking the insertion site within pET21 ( using primers T7-F and T7-R). Unfortunately, no positive transformant was detected (fig. 3).</p>
+
<p>24 transformants were screened by colony PCR with primers flanking the insertion site within pET21 (using primers T7-F and T7-R). Unfortunately, no positive transformant was detected (fig. 3).</p>
  
  
  
 
<h2>Conclusion</h2>
 
<h2>Conclusion</h2>
−
<p>Due to unsuccessful cloning of this part, we weren't able to progress further with this component and BBa_K4768005, hindering our ability to test the functionality of this biosensor system. Due to time constraints, we couldn't explore alternative cloning strategies thoroughly. We encourage future iGEM teams to consider different cloning approaches, continue the characterization of the biosensor, and feel free to contact us for additional information.</p>
+
<p>Due to unsuccessful cloning of this part, we were not able to progress further with this component and <a href="https://parts.igem.org/Part:BBa_K4768005" target="blank">BBa_K4768005</a> and could not test its functionality. Due to time constraints, we could not explore alternative cloning strategies thoroughly. We encourage future iGEM teams to consider different cloning approaches and continue the characterization of the biosensor. Feel free to contact us for additional information!</p>
  
 
<h2>References</h2>
 
<h2>References</h2>

Latest revision as of 08:53, 11 October 2023


Split T7 RNA polymerase Cterm conjugated to Trastuzumab with a soluble linker

Part for expression of the split T7 RNA polymerase Cterm conjugated to Trastuzumab with a soluble linker in PURE System

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 40
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 40
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 40
    Illegal NgoMIV site found at 1080
    Illegal AgeI site found at 549
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 21


Introduction

Figure 1: Trastuzumab-SL-T7Cterm structure

The CALIPSO part BBa_K4768006 is composed of the anti-HER2 antibody Trastuzumab fused to the C-terminal subunit of the T7 RNA polymerase (residues 181 to 704) through a soluble linker. This gene is under transcriptional control of an SP6 promoter and T7 terminator.

This part, coupled to the part BBa_K4768005 containing the N-terminal subunit of the T7 RNA polymerase, has been designed to develop a split T7 RNAP-based biosensor capable of recognizing HER2, an epidermal growth factor that is overexpressed in cancer cells [1], in solution.

The HER2-induced T7 RNAP complex was designed from two existing constructs: a split T7 RNAP-based biosensor for the detection of rapamycin [2] and a split luciferase conjugated with antibodies capable of recognizing HER2 [3]. We decided to merge the relevant functionalities of these two constructs and created a new biosensor that transduces HER2 binding to gene expression activation.

Figure 2: Recognition of HER2 extracellular domain induces functional assembly of the split T7 RNA polymerase, which enables gene expression of target gene under control of a T7 promoter.

Construction

The CALIPSO part BBa_K4768006 consists in the C-terminal subunit of the T7 RNA polymerase fused to Trastuzumab, an anti-HER2 antibody, on its C-terminal domain through an 8-amino-acid linker of glycine and serine residues. The synthesis of this gBlock was made by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.

We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):

  • Primer T7-F: agttcctcctttcagatttaggtgacactataggggagac
  • Primer T7-R: gagatctcgatcccgcaaaaaacccctcaagacccg

    • Figure 3: Agarose gel electrophoresis or PCR screening on plasmids extracted from 24 clones.

    24 transformants were screened by colony PCR with primers flanking the insertion site within pET21 (using primers T7-F and T7-R). Unfortunately, no positive transformant was detected (fig. 3).

    Conclusion

    Due to unsuccessful cloning of this part, we were not able to progress further with this component and BBa_K4768005 and could not test its functionality. Due to time constraints, we could not explore alternative cloning strategies thoroughly. We encourage future iGEM teams to consider different cloning approaches and continue the characterization of the biosensor. Feel free to contact us for additional information!

    References

    1. Jois et al. 2021. Peptidomimetic Ligand-Functionalized HER2 Targeted Liposome as Nano-Carrier Designed for Doxorubicin Delivery in Cancer Therapy. Pharmaceuticals. 14(3). 221
    2. Pu, J., Zinkus-Boltz, J., Dickinson, B. C. 2017. Evolution of a split RNA polymerase as a versatile biosensor platform. Nat Chem Biology 13(4). 432-438.
    3. Stains, C. I., Furman, J. L., Porter, J. R., Rajagopal, S., Li, Y., Wyatt, R. T., Ghosh, I. 2010. A General Approach for Receptor and Antibody-Targeted Detection of Native Proteins utilizing Split-Luciferase Reassembly. ACS Chem Biol 5(10). 943-952
      4.