Difference between revisions of "Part:BBa K4768004"
 
(2 intermediate revisions by 2 users not shown)
Line 26: Line 26:
 
             <img
 
             <img
 
             class="d-block"
 
             class="d-block"
−
             style="width:90%;"
+
             style="width:70%;"
 
             src="https://static.igem.wiki/teams/4768/wiki/parts/bba-k4768004.png">  
 
             src="https://static.igem.wiki/teams/4768/wiki/parts/bba-k4768004.png">  
 
             <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: Pyrimidine/purine nucleoside phosphorylase ppnP part</b></i></span></figcaption>
 
             <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: Pyrimidine/purine nucleoside phosphorylase ppnP part</b></i></span></figcaption>
Line 32: Line 32:
 
</div>
 
</div>
  
−
<p>The part (BBa_K4768004) includes the <i>E. coli</i> Pyrimidine/purine nucleoside phosphorylase gene, controlled by a T7 promoter with an operator sequence called dhdO. This part take place in our project by the encoding enzyme is responsible for the conversion of Tegafur (a prodrug) into 5-Fluorouracil (an active drug). </p>
+
<p>The part BBa_K4768004 includes the <i>E. coli</i> Pyrimidine/purine nucleoside phosphorylase gene, controlled by a T7 promoter with an operator sequence called dhdO. This part take place in our project by the encoding enzyme is responsible for the conversion of Tegafur (a prodrug) into 5-Fluorouracil (an active drug). </p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
Line 43: Line 43:
 
         <figure class="normal mx-auto">     
 
         <figure class="normal mx-auto">     
 
             <img class="d-block"
 
             <img class="d-block"
−
             style="width:75%;"
+
             style="width:60%;"
 
             src="https://static.igem.wiki/teams/4768/wiki/registry/fig-ppnp-migration.png">  
 
             src="https://static.igem.wiki/teams/4768/wiki/registry/fig-ppnp-migration.png">  
 
             <figcaption class="normal"><span class="titre-image"><i><b>Figure 2:</b> Migration of <i>ppnP </i>PCR products into a 0.8% agarose gel and EtBr staining.</i></span></figcaption>                                                 
 
             <figcaption class="normal"><span class="titre-image"><i><b>Figure 2:</b> Migration of <i>ppnP </i>PCR products into a 0.8% agarose gel and EtBr staining.</i></span></figcaption>                                                 
Line 50: Line 50:
  
 
<h2>Characterisation</h2>
 
<h2>Characterisation</h2>
−
<p>We attempted to produce E. coli purine/pyrimidine nucleoside phosphorylase (Ppnp) in two different PURE system kits with different protein folding properties (PUREfrex2.0 and PUREfrex2.1). . Tegafur at a final concentration of 119 µM and the gene encoding PpnP under T7 polymerase control were added in each sample. Tegafur and 5-FU concentrations were analyzed by HPLC at time zero and after 12 hours incubation at 37°C (Table 1). </p>
+
<p>We attempted to produce <I>E. coli</I> purine/pyrimidine nucleoside phosphorylase (Ppnp) in two different PURE system kits with different protein folding properties (PURE<I>frex</I>2.0 and PURE<I>frex</I>2.1). Tegafur at a final concentration of 119 µM and the gene encoding PpnP under T7 polymerase control were added in each sample. Tegafur and 5-FU concentrations were analyzed by HPLC at time zero and after 12 hours incubation at 37°C (Table 1). </p>
  
  

Latest revision as of 08:34, 11 October 2023


Recombinant Pyrimidine/purine nucleoside phosphorylase (ppnP) from E. coli

E. coli nucleoside phosphorylase ppnP under control of a T7 promoter with an operator site known as dhdO for expression in PURE system

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



Introduction

Figure 1: Pyrimidine/purine nucleoside phosphorylase ppnP part

The part BBa_K4768004 includes the E. coli Pyrimidine/purine nucleoside phosphorylase gene, controlled by a T7 promoter with an operator sequence called dhdO. This part take place in our project by the encoding enzyme is responsible for the conversion of Tegafur (a prodrug) into 5-Fluorouracil (an active drug).

Construction

The ppnP gene was obtained from Dr. Baixing Wu, an Associate Professor at the RNA Biomedical Institute, Medical Research Center at Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University. Dr. Wu is the author of the article titled "Crystal structures of a new class of pyrimidine/purine nucleoside phosphorylase revealed a Cupin fold" [1] The ppnP gene was placed under the control of a T7 promoter with an operator site known as dhdO. The synthesis of the gBlock of this part was carried out and provided by IDT (Integrated DNA Technologies).

We amplified the gBlock by PCR using the following primers(from 5' to 3'):

  • T7-term-F : AGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACC
  • T7-prom-R : GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG
    • Figure 2: Migration of ppnP PCR products into a 0.8% agarose gel and EtBr staining.

    Characterisation

    We attempted to produce E. coli purine/pyrimidine nucleoside phosphorylase (Ppnp) in two different PURE system kits with different protein folding properties (PUREfrex2.0 and PUREfrex2.1). Tegafur at a final concentration of 119 µM and the gene encoding PpnP under T7 polymerase control were added in each sample. Tegafur and 5-FU concentrations were analyzed by HPLC at time zero and after 12 hours incubation at 37°C (Table 1).

    Table 1: Estimated concentrations of Tegafur and 5-FU at time zero (T-0h) and after 12 hours (T-12h) of incubation at 37°C under different conditions (as indicated above).

    After 12 hours of incubation, we expected to observe the enzymatic conversion of Tegafur into 5-FU by the purine/pyrimidine nucleoside phosphorylase. Unfortunately, the peak of Tegafur did not decrease and no additional peak of 5-FU appeared.

    Conclusion and Perspectives

    We can conclude either that the produced enzyme was not active, hence Tegafur was not converted into 5-FU, or that the amount of synthesized enzyme was too low to lead to detectable changes in Tegafur and 5-FU concentrations, or that the PpnP folding was incorrect.

    We recommend doing necessary sequence optimization of the ppnP gene to increase expression levels and to supplement the PURE system with chaperones to enhance and facilitate protein folding.

    The construction, the expression in PURE system, and the HPLC analysis performed with this part BBa_K4768004 in the BSL1 laboratory.

    References

    1. [1] Wen, Y., Li, X., Guo, W., & Wu, B. (2022). Crystal structures of a new class of pyrimidine/purine nucleoside phosphorylase revealed a Cupin fold. Proteins: Structure, Function, and Bioinformatics, 90(6), 1233–1241.
    2. [2] Serra, I., Bavaro, T., Cecchini, D. A., Daly, S., Albertini, A. M., Terreni, M., & Ubiali, D. (2013). A comparison between immobilized pyrimidine nucleoside phosphorylase from Bacillus subtilis and thymidine phosphorylase from Escherichia coli in the synthesis of 5-substituted pyrimidine 2′-deoxyribonucleosides. Journal of Molecular Catalysis B: Enzymatic, 95, 16–22
      3.