Difference between revisions of "Part:BBa K4768003"
| (14 intermediate revisions by 2 users not shown) | |||
| Line 3: | Line 3: | ||
<partinfo>BBa_K4768003 short</partinfo> | <partinfo>BBa_K4768003 short</partinfo> | ||
| − | + | human thymidine phosphorylase gene under control of a T7 promoter with an operator site known as <i>dhdO</i> for expression in PURE system | |
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
| Line 32: | Line 32: | ||
</div> | </div> | ||
| − | <p>The CALIPSO part | + | <p>The CALIPSO part BBa_K4768003 consists of the human Thymidine Phosphorylase <i>tymp</i> gene, optimized for expression in <i>E. coli</i>. This part encodes the human thymidine phosphorylase (TYPH) enzyme, which can convert Tegafur into 5-Fluorouracil. This gene is under transcriptional control of a T7 promoter and T7 terminator.</p> |
<h2>Construction</h2> | <h2>Construction</h2> | ||
| − | <p>The cDNA of the tymp gene was taken from the Uniprot database and sequence-optimized for expression in E. coli using IDT (Integrated DNA Technologies) tools. The tymp gene was inserted downstream a T7 promoter with an operator site known as <i>dhdO<i>. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid and introduced into Stellar competent cells. | + | <p>The cDNA of the <I>tymp</I> gene was taken from the Uniprot database and sequence-optimized for expression in <I>E. coli</I> using IDT (Integrated DNA Technologies) tools. The <i>tymp </i>gene was inserted downstream a T7 promoter with an operator site known as <i>dhdO</i>. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells. |
</p> | </p> | ||
| Line 42: | Line 42: | ||
<li>T7-prom-R : GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG</li> <p> | <li>T7-prom-R : GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG</li> <p> | ||
| − | <div | + | <div align="center"> |
| − | < | + | <figure class="normal mx-auto"> |
| − | < | + | <img class="d-block" |
| − | + | style="width:60%;" | |
| − | + | src="https://static.igem.wiki/teams/4768/wiki/experiments/cloning/figure3.png"> | |
| + | <figcaption class="normal"><span class="titre-image"><i><b>Figure 2: Construction of the plasmid pET21_tymp.</b> (A) Agarose gel electrophoresis of the PCR products generated from the gBlock and pET21 plasmid. 0.8% agarose and EtBr staining were used. (B) Positive clones were identified from the colony PCR screening. T+ and T- refer to positive control (gBlock amplification) and negative control (without DNA matrix), respectively. (C) Double and single-enzymatic digestion of the pET21_tymp derived from clone 4 by EcoRV and BamHI (Simulated (left) and experimental (right) patterns) | ||
| + | </i></span></figcaption> | ||
| + | </figure> | ||
| + | </div> | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
</div> | </div> | ||
<p>Cloning was successful and two plasmids from positive clones (10 and 21) were sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation.<p> | <p>Cloning was successful and two plasmids from positive clones (10 and 21) were sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation.<p> | ||
<h2>Characterisation</h2> | <h2>Characterisation</h2> | ||
| − | <p>We attempted to produce | + | <p>We attempted to produce TYPH enzyme in PURE system from the isolated plasmids and also PCR product of the part. Unfortunately, SDS-PAGE analysis of the expression products did not reveal a band of the size of the Thymidine phosphorylase protein (fig. 3).</p> |
| − | <div | + | |
| − | < | + | |
| − | < | + | <div align="center"> |
| − | + | <figure class="normal mx-auto"> | |
| − | + | <img class="d-block" | |
| − | + | style="width:60%;" | |
| − | + | src="https://static.igem.wiki/teams/4768/wiki/registry/gfp-part/gfp-fig-3.png"> | |
| − | + | <figcaption class="normal"><span class="titre-image"><i><b>Figure 3: SDS-page migration (Mini-PROTEAN TGX Stain-free Gels) and Overlay of the green lys revelation and stain free revelation.</b> negative control without DNA (lane 1), DHFR used as positive control is visible at 18 kDa (lane 2), PCR product of Thymidine phosphorylase Typh visible at 52 kDa (lane 3),PCR product of <I>sfgfp</i> visible at 26 kDa and PCR product of<i> nb anti-HER2 </i>visible at 17 kDa (lane 5). The protein marker is in lane 6.</i></span></figcaption> | |
| − | + | </figure> | |
| − | + | ||
| − | + | ||
| − | + | ||
</div> | </div> | ||
| + | |||
<h2>Conclusion and Perspectives</h2> | <h2>Conclusion and Perspectives</h2> | ||
| − | <p>Given the absence of literature data about the production of the human | + | <p>Given the absence of literature data about the production of the human TYPH enzyme in a bacterial system, and the difficulty we faced in obtaining from the authors the <I>tymp</i> gene reported in the article <a href="https://www.frontiersin.org/articles/10.3389/fbioe.2021.793985/full">[1],</a>we opted to use the <I>E. coli</I> pyrimidine/purine nucleoside phosphorylase sequence. This gene has already been used in the literature and the sequence was provided to us by the authors <a href="https://onlinelibrary.wiley.com/doi/10.1002/prot.26309">[2].</a></p> |
<p>The construction and the expression in PURE system of this part BBa_K4768003 can be performed in the BSL1 laboratory. <p> | <p>The construction and the expression in PURE system of this part BBa_K4768003 can be performed in the BSL1 laboratory. <p> | ||
Latest revision as of 08:30, 11 October 2023
Recombinant human Thymidine Phosphorylase (TYMP)
human thymidine phosphorylase gene under control of a T7 promoter with an operator site known as dhdO for expression in PURE system
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1536
Illegal XhoI site found at 1531 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 1407
- 1000COMPATIBLE WITH RFC[1000]
Introduction
The CALIPSO part BBa_K4768003 consists of the human Thymidine Phosphorylase tymp gene, optimized for expression in E. coli. This part encodes the human thymidine phosphorylase (TYPH) enzyme, which can convert Tegafur into 5-Fluorouracil. This gene is under transcriptional control of a T7 promoter and T7 terminator.
Construction
The cDNA of the tymp gene was taken from the Uniprot database and sequence-optimized for expression in E. coli using IDT (Integrated DNA Technologies) tools. The tymp gene was inserted downstream a T7 promoter with an operator site known as dhdO. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.
We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):
Cloning was successful and two plasmids from positive clones (10 and 21) were sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation.
Characterisation
We attempted to produce TYPH enzyme in PURE system from the isolated plasmids and also PCR product of the part. Unfortunately, SDS-PAGE analysis of the expression products did not reveal a band of the size of the Thymidine phosphorylase protein (fig. 3).
Conclusion and Perspectives
Given the absence of literature data about the production of the human TYPH enzyme in a bacterial system, and the difficulty we faced in obtaining from the authors the tymp gene reported in the article [1],we opted to use the E. coli pyrimidine/purine nucleoside phosphorylase sequence. This gene has already been used in the literature and the sequence was provided to us by the authors [2].
The construction and the expression in PURE system of this part BBa_K4768003 can be performed in the BSL1 laboratory.
References
- [1]Karamitros, C. S., Somody, C. M., Agnello, G., & Rowlinson, S. (2021). Engineering of the Recombinant Expression and PEGylation Efficiency of the Therapeutic Enzyme Human Thymidine Phosphorylase. Frontiers in Bioengineering and Biotechnology, 9.
- [2] Wen, Y., Li, X., Guo, W., & Wu, B. (2022). Crystal structures of a new class of pyrimidine/purine nucleoside phosphorylase revealed a Cupin fold. Proteins: Structure, Function, and Bioinformatics, 90(6), 1233–1241.