Difference between revisions of "Part:BBa K4768000"

Latest revision as of 21:44, 10 October 2023

DhdR repressor

Part for expression and purification of our transcriptional repressor DhdR for biosensing.

Sequence and Features

Assembly Compatibility:

10
INCOMPATIBLE WITH RFC[10]
Illegal XbaI site found at 47
12
COMPATIBLE WITH RFC[12]
21
INCOMPATIBLE WITH RFC[21]
Illegal BglII site found at 493
Illegal BglII site found at 622
23
INCOMPATIBLE WITH RFC[23]
Illegal XbaI site found at 47
25
INCOMPATIBLE WITH RFC[25]
Illegal XbaI site found at 47
1000
INCOMPATIBLE WITH RFC[1000]
Illegal BsaI.rc site found at 756

Introduction

The CALIPSO part BBa_K4768000 consists of the transcriptional repression factor, DhdR, which has been isolated from the bacterium Achromobacter denitrificans. The codon sequence has been optimized for expression in E. coli. Additionally, the presence of a T7 promoter and terminator enables its inducible expression by IPTG in E. coli BL21 (DE3). Finally, a Histidine tag is included in the sequence to facilitate the purification of DhdR.

This transcriptional repressor was employed in the biosensing system, which was inspired by the work of Ping Xu et al. [1] and the work conducted by iGEM Duke 2021. The aim was to utilize the oncometabolite 2-Hydroxyglutarate (2-HG), to lift DhdR-mediated gene repression, thereby initiating an in situ drug-activating enzyme production. To achieve this, we positioned the gene of interest under the control of the operator site of DhdR, referred to as dhdO (BBa_K4046100)

**Figure 2: Operating principle of the biosensor.** In presence of 2-HG, repression is removed and the gene is expressed leading to the production of the thymidine phosphorylase which converts the Tegafur prodrug into an active anticancer drug, 5-fluorouracile.

Construction

The CALIPSO part BBa_K4768000 comprises the transcriptional repression factor DhdR fused with a histidine tag at its N-terminus. The synthesis of this gBlock was performed and provided by IDT.

The gBlock was then cloned into the pET_21a(+) plasmid and transformed into Stellar competent cells.

Primers used to clone this part in the pET21: (from 5' to 3'):

DhdR-pET21-F: AGCAGCCGGATCTCATCATGACGTCTGACGCGC
DhdR-pET21-R: GAAGGAGATATACATATGGGCCATCATCATCATCATC

Figure 3 shows the enzymatic restriction pattern of the resulting clones. Clone 4 was digested using EcoRV and NdeI. Two bands were expected at 1.3 kb and 4.8 kb, as experimentally measured (lane 5).

**Figure 3: Enzymatic digestion of the plasmid part** extracted from clone 4. Patterns from simple digestion by EcoRV or by NdeI, and double digestion by both enzymes are shown.

Clone 4 was sequence verified.

Characterization

1) Production and purification of DhdR

The pET21a(+) vector including the dhdR insert was transformed into E. coli strain BL21 (DE3). This strain was provided by Cédric Montanier (researcher at TBI). When DO reaches 0.5-0.6, expression of the recombinant protein was induced overnight at 16°C using IPTG. The His-tagged protein was then purified on TALON® Metal Affinity Resin. Pure fractions were assessed by SDS-PAGE. Results are shown in Figure 4.

**Figure 4: SDS-PAGE analysis of the different steps of the DhdR purification:** protein ladder (SE250 Mighty Small II Mini Vertical Protein Electrophoresis Unit), pellet DhdR, cell-free extract (CFE), flowthrough (FT), wash (W), elution with 50 mM imidazole, 100 mM imidazole, 250 mM imidazole and 500 mM imidazole (respectively E1₅₀, E1₁₀₀, E1₂₅₀ and E1₅₀₀). The band corresponding to the protein was clearly identified by Coomassie Blue staining.

The expected size for DhdR is 28.27 kDa. Clear bands were observed for the four elution fractions E1₅₀, E1₁₀₀, E1₂₅₀ and E1 500, but not in the negative control sample, as expected. These data show that DhdR was efficiently purified and can be used for subsequent assays.

The E1₂₅₀ fraction was dialysed leading to a concentration of 14.4 µM (> 95% pure protein). Fractions E1₁₀₀ and E1₅₀₀ were pooled and dialysed, resulting in a concentration of 7.63 µM (> 95% pure protein).

2) Functionality tests in PURE system

The aim of the experiments was to establish that the binding of the repressor DhdR to its operator site, dhdO, effectively inhibits transcription of a gene of interest regulated by dhdO. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system (GeneFrontier).

Inhibition was tested on the sfgfp reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. The biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.

**Figure 5: Effect of different concentrations of DhdR on the expression of a fluorescent reporter gene.** Experiments 1 and 2 were performed with the same batch of PCR product from clone 8, while a new batch of PCR product from the same clone was used in experiment 3. PUREfrex2.0 was used in all conditions. The intensity value of sfGFP without DhdR was used for normalization. Excitation and emission wavelengths were 488 nm and 510 nm, respectively.

As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 5). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a dhdO operator sequence was 1.5 µM, validating the predictions of the biochemical network model.

Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 6). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.

**Figure 6: Effect of different concentrations of 2-HG on DhdR repression.** PUREfrex2.1 was used. The intensity value of sfGFP without DhdR and with 10 µM 2-HG was used for normalization. Each concentration was corrected taking into account the inactivation effect of 2-HG on PURE system.

3) In-liposome expression of the sfgfp gene

DhdR repression in liposomes

Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.

Figure 7a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 7b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (no sfGFP expressed) (Fig. 7c).

**Figures 7:** a) Liposomes were localized with a fluorescent membrane dye. b) Zoom-in image of the liposome area depicted with a red arrow on fig. 7a. A yellow line crossing the liposome has been appended. c) Fluorescence intensity profile along the line appended in b. The two peaks correspond to the two regions of membrane crossing.

Figure 8a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 8b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 8c.

**Figures 8: Fluorescence microscopy image of liposomes in the GFP channel.** Expressed sfGFP signal was localized in the liposome lumen. a) Large field-of-view. b) Blow-up of the liposome depicted with the red arrow in a. c) Intensity profile along the yellow line appended in b.

Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes.

Liposomes are capable of expressing GFP in the presence of living cancer cells

Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated at 37°C for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for in situ gene expression (sample 2). The latter protocol more closely mimics the in vivo conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.

In sample 1, in the field of view displayed in Figures 9, two liposomes were localized using the fluorescent membrane dye (Fig. 9b) but only one exhibits sfGFP signal (Fig. 9c).

**Figures 9: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 1).** a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of liposomes localized with a fluorescent membrane dye. c) Imaging of liposomes in the GFP channel.

Similar results were obtained with sample 2, as shown in Figures 10.

**Figures 10: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 2).** a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of a liposome localized with a fluorescent membrane dye. c) Imaging of the same liposome in the GFP channel.

No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.

Molecular Modeling

1) Model-driven feasibility assessment of the 2-HG biosensor

The impact of DhdR on cell-free expression was modeled through a set of differential equations inspired from iGEM Teams Duke 2021 and Delft 2021, and implemented on COPAS v(4.38).

The responsiveness of the anticancer liposome to a tumoral environment is a key design feature for limiting toxic side-effects. We thus used the model to evaluate whether 5-FU was produced at higher concentration in the presence of 2-HG (synthesized by cancer cells) compared to its absence. In absence of 2-HG, we expect the expression of TYPH to be repressed and, therefore, only a small amount of 5-FU would be produced. Consistently, simulations shown in Fig. 3 predicted that 1.5 μM of DhdR repressed gene expression, resulting in a ~2-fold lower concentration of 5-FU outside the liposome. Adding 100 μM of 2-HG, corresponding to typical concentrations in surrounding tumors [2], derepressed the system and boosted 5-FU production. The model therefore met the behavior expected for liposomes and confirmed that the targeted drug production strategy could help tackle adverse effects of current chemotherapies.

**Figure 11: Concentration of 5-FU after 6 hours in presence or absence of DhdR and 2-HG** (concentrations are as indicated), with an initial Tegafur concentration of 1000 μM.

2) Guiding experiments and validating the model

We used the model to determine the optimal concentration of DhdR to be encapsulated in the liposome. To that aim, we built a reduced model containing only the biosensing and gene expression modules, along with a gene encoding the sfGFP protein that was used in the experiments as a reporter. To verify model predictions, we carried out the same experiments as done in silico using the same concentration range of DhdR and 2-HG.

A gradual decrease in the fluorescence intensity, i.e., in the expression of sfgfp, was experimentally verified when increasing the concentration of DhdR. Importantly, measurements are consistent with the model predictions qualitatively, confirming the parameter values and structure of the model.

Experimental results confirm that increasing 2-HG concentration progressively lifts the repression caused by DhdR. However, the model poorly predicted the gradual increase of sfGFP levels measured experimentally, as it was more sensitive to lower concentrations of 2HG.

We thus decided to use measurements to refine the model. We estimated the values of different parameters of the biosensing module (k_D2, k_-D2, k_D0, k_-D0, k_DH and k_-DH) by fitting the experimental data. In comparison to the predictions of the ab initio model constructed from the literature, the simulations with the refined parameter values were in quantitative agreement with measurements. Importantly, the refined model with the calibrated biosensor module was also able to accurately simulate protein expression levels in the presence of 2-HG, corroborating its improved predictive power (Fig. 11). You can find the program used in the post-calibration Gitlab folder

.

**Figures 12: Comparison of the predictive capabilities of the kinetic model before (in pink) and after calibration (in green) using experimental data as inputs (in red).** (A) Concentrations of DhdR were as indicated and 2-HG was not present. (B) Concentration of DhdR was fixed to 1.5 µM and different concentrations of 2-HG were used as indicated.

Conclusion and Perspectives

These experiments provide evidence that the 2-HG biosensor that relies on the part BBa_K4768000 is functional in bulk reactions at concentrations of oncometabolite that are physiologically relevant. The biochemical network model was used to predict DhdR concentrations, and then optimized according to experimental results. Moreover,we established a protocol for encapsulating DhdR, the expression product of the part BBa_K4768000, inside liposomes. Although DhdR-based repression was not clearly demonstrated in vesicles, we gave recommendations and provided image analysis tools for future investigations.

This construction can be manipulated in a Biosafety level 1 laboratory.

References

Xiao, D., Zhang, W., Guo, W., Liu, Y., Hu, C., Guo, S., Kang, Z., Xu, X., Ma, C., Gao, C., & Xu, P. 2021. A D-2-hydroxyglutarate biosensor based on specific transcriptional regulator DhdR. Nature Communications 12, 7108.

Jezek, P. 2020. 2-Hydroxyglutarate in Cancer Cells. Antioxid Redox Signal, 33(13),903-926.

@@ Line 3: / Line 3: @@
 <partinfo>BBa_K4768000 short</partinfo>
+Part for expression and purification of our transcriptional repressor DhdR for biosensing.
+<!-- Add more about the biology of this part here
+===Usage and Biology===
+<!-- -->
 <span class='h3bb'>Sequence and Features</span>
-<partinfo>BBa_K2668010 SequenceAndFeatures</partinfo>
+<partinfo>BBa_K4768000 SequenceAndFeatures</partinfo>
+<!-- Uncomment this to enable Functional Parameter display
+===Functional Parameters===
+<partinfo>BBa_K4768000 parameters</partinfo>
+<!-- -->
 <html>
 <h2>Introduction</h2>
-<p>TXXXXXX.</p>
-<h2>Construction</h2>
-<p>XXXXXXXXXXXXXXXXX.</p>
+<div align="center">
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:60%;"
+            src="https://static.igem.wiki/teams/4768/wiki/parts/part-000.png">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: DhdR part</b>
+</i></span></figcaption>
+        </figure>
+</div>
-<div class="center">
+<p>The CALIPSO part BBa_K4768000 consists of the transcriptional repression factor, DhdR, which has been isolated from the bacterium <i>Achromobacter denitrificans</i>. The codon sequence has been optimized for expression in <i>E. coli</i>. Additionally, the presence of a T7 promoter and terminator enables its inducible expression by IPTG in <i>E. coli</i> BL21 (DE3). Finally, a Histidine tag is included in the sequence to facilitate the purification of DhdR.</p>
-        <div class="thumb tnone">
+<p> This transcriptional repressor was employed in the biosensing system, which was inspired by the work of Ping Xu <i>et al</i>. <a href=”https://www.nature.com/articles/s41467-021-27357-7”/>[1]</a> and the work conducted by iGEM Duke 2021. The aim was to utilize the oncometabolite 2-Hydroxyglutarate (2-HG), to lift DhdR-mediated gene repression, thereby initiating an <i>in situ</i> drug-activating enzyme production.
-            <div class="thumbinner" style="width:50%;">
+To achieve this, we positioned the gene of interest under the control of the operator site of DhdR, referred to as dhdO <a href=”https://parts.igem.org/Part:BBa_K4046100/>(BBa_K4046100)</a></p>
-                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
-                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+<div align="center">
-                    <div class="magnify">
+        <figure class="normal mx-auto">
-                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
+            <img class="d-block"
-                    </div>
+            style="width:60%;"
-                    <b>Figure 1: </b> <b>Analyses of pSB1C3_ CBM3- monomeric streptavidin – AzF length and restriction map</b>
+             src="https://static.igem.wiki/teams/4768/wiki/module-2/unnamed-2.png">
-                    The plasmids of 5 obtained clones were analysed to check their length. XbaI/NcoI digested plasmids (clones 1 to 5) are electrophoresed through a 1% agarose gel. Lane 1 is the Smart DNA ladder (Eurogentec), the 0.4kb, 1.5 kb and 3kb DNA fragments are annotated. Lane 2 to  6 are the digested plasmids resulting from DNA extraction of the 5 clones.
+            <figcaption class="normal"><span class="titre-image"><i><b>Figure 2: Operating principle of the biosensor.</b> In presence of 2-HG, repression is removed and the gene is expressed leading to the production of the thymidine phosphorylase which converts the Tegafur prodrug into an active anticancer drug, 5-fluorouracile.
-                </div>
+</i></span></figcaption>
-            </div>
+         </figure>
-        </div>
-    </div>
-<h2>Molecular Modeling</h2>
-<p>Modelling this three-headed fusion protein presented a complex challenge, requiring a multi-step and multi-level strategy relying on various molecular modelling and simulation methods. We used available X-ray structure data from the Protein Data Bank, integrated 3D structure prediction tools, employed innovative robotics inspired artificial intelligence methods to explore the intrinsically disordered regions, built and parametrised the unnatural amino acid aziodphenyalanine, and finally studied its behaviour over time through molecular dynamics simulations in a large explicit solvent water box. The results of the molecular dynamics simulation comforted us in the stability of our construction as the domains kept their structure over 90ns of simulation as showed in figure 2.</p>
-<div class="center">
-    <div class="thumb tnone">
-        <div class="thumbinner" style="width:80%;">
-             <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
-                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
-                <div class="magnify">
-                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
-                </div>
-                <b>Figure 2: </b> <b>Molecular Dynamics simulation of Cerberus in a water box (not showed) for 90ns  </b>
-                In Red streptavidin, in orange the TEV Cleavage site, in yellow the endogenous <em>N</em>-terminus linker, in green the CBM3a, in light blue the endogenous <em>C</em>-terminus linker, in magenta the biotin and in blue the FITC clicked on the AzF.
-            </div>
-         </div>
-    </div>
 </div>
-<h2>Characterisation</h2>
-<h3>Production of Cerberus</h3>
+<h2>Construction</h2>
-<p>The fusion between the streptavidin linker and CBM3a platform sequences followed by the amber stop codon was cloned into the pET28 (containing an His Tag) expression vector using In-Fusion Cloning Kit. pET28 was digested by NcoI and HindIII and the part was amplified using the primer pairs stated below. The resulting construct was co-transformed along the pEVOL-AzF expression vector (coding for amino acyl tRNA synthetase (aarS)/tRNA orthogonal pair for <i>in vivo</i> incorporation in <em>E. coli</em> under L-arabinose induction) into <i>E. coli</i> strain BL21. pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid # 31186). Expression of the recombinant protein was induced using IPTG and L-arabinose, with addition of AzF in the medium. The synthesis of aaRS/tRNA pair was first induced with L-arabinose and AzF added at the same time. One hour later, the production of Cerberus was triggered with IPTG. The His-tagged protein was then purified on IMAC resin (Sigma) charged with cobalt. Results are shown on figure 3.</p>
+<p> The CALIPSO part BBa_K4768000 comprises the transcriptional repression factor DhdR fused with a histidine tag at its N-terminus. The synthesis of this gBlock was performed and provided by IDT.</p>
-<p>Primer used to clone this part in the pET28: (from 5' to 3')</p>
+<p> The gBlock was then cloned into the pET_21a(+) plasmid and transformed into Stellar competent cells. </p>
+Primers used to clone this part in the pET21: (from 5' to 3'):
 <ul>
-     <li>Cerberus_pET_Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
+     <li> DhdR-pET21-F: AGCAGCCGGATCTCATCATGACGTCTGACGCGC</li>
-     <li>Cerberus_pET_Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
+     <li> DhdR-pET21-R: GAAGGAGATATACATATGGGCCATCATCATCATCATC</li>
 </ul>
-<p>Primer used to clone this part in the pSB1C3: (from 5' to 3')</p>
-<ul>
-    <li>Cerberus_pSB1C3_Forward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
-    <li>Cerberus_pSB1C3_Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
-</ul>
-<div class="center">
-        <div class="thumb tnone">
-            <div class="thumbinner" style="width:50%;">
-                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" class="image">
-                    <img alt="" src="/wiki/images/5/57/T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
-                    <div class="magnify">
-                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" class="internal" title="Enlarge"></a>
-                    </div>
-                    <b>Figure 3: </b> <b>SDS-PAGE analysis of the production of Cerberus </b>
-                    NI: non-induced, I-AzF: induced without AzF, I+AzF: induced with AzF, E1: elution with 40 mM imidazole, E2: elution with 100 mM imidazole, E3: elution with 100 mM imidazole, MW: molecular weight ladder
-                </div>
-            </div>
-        </div>
-    </div>
-<p>Induction in the presence  of AzF (lane I+AzF) led to the expression of two major bands at 37 and 39 kDa approximately compared to control conditions, namely the non-induced (lane NI) and induced without AzF (lane I-AzF). We hypothesized that the upper and the lower bands could correspond to Cerberus (expected molecular weight of monomeric Cerberus: 41 kDa), and a version of Cerberus lacking AzF and therefore the His Tag (39kDa expected). Surprisingly, both bands were still present in the elution fractions which seems incoherent since the band lacking the His-tag was supposed to be washed out during purification steps. To confirm our hypothesis, we analysed the same fractions by western blot using antibodies directed against the His-tag (Figure 4)</p>
-<div class="center">
-        <div class="thumb tnone">
-            <div class="thumbinner" style="width:50%;">
-                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" class="image">
-                    <img alt="" src="/wiki/images/d/dc/T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
-                    <div class="magnify">
-                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" class="internal" title="Enlarge"></a>
-                    </div>
-                    <b>Figure 4: </b> <b>Western Blot with anti His tag antibodies of Cerberus production </b>
-                    NI: non-induced, I-AzF: induced without AzF, I+AzF: induced with AzF, E: elution, MW: molecular weight ladder, Ctrl N-ter: Control protein with an <em>N</em>-terminus His Tag, Ctrl C-ter: Control protein with an <em>C</em>-terminus His Tag.
-                </div>
-            </div>
-        </div>
-    </div>
-<p>Anti-His-tag antibodies revealed a band at about 45 kDa in the sample corresponding to IPTG induction in the presence of AzF (lane I+AzF). This band is not present in control samples (lane NI and I-AzF), indicating that it corresponds to the Cerberus protein (theoretical size: 41 kDa). In addition to the full length protein, we observed several extra bands which very likely correspond to proteolysis products since they are detected with the anti-His-tag antibodies. Moreover, the band at 45 kDa is clearly detected in elution samples (lanes E). The purification level of Cerberus with monomeric streptavidin in the elution samples was estimated about 62%. These data show that Cerberus was efficiently purified and can be used for subsequent assays. In addition, these results show that experimental setup to produce Cerberus also leads to the production of a protein where the amber stop codon has not been recognized by the AzF-charged orthogonal tRNA (a construction we named Orthos in our project). Although Orthos does not contain a His-tag at its C-terminus, the protein seems to be efficiently co-purified with Cerberus. The basis of this observation is unclear but this result may suggest that Orthos and Cerberus interact together.</p>
-<h3>Validation of Cerberus</h3>
-    <h4>Validation of the AzF and CBM3a heads using FITC (Fluorescein isothiocyanate) molecules</h4>
-<p>To validate both the AzF and CBM3a heads of Cerberus, we challenged its potential to functionalize cellulose with fluorescence. To generate a fluorescently labelled Cerberus protein, we first performed a SPAAC reaction on 3.2 µM Cerberus protein using 31.9 µM of FITC-DBCO (Jena Bioscience). In the control experiment, 31.9 µM of FITC alone was used. These samples were then incubated with cellulose for 16 hours and after several washes with resuspension buffer (50mM Tris HCl pH 8), fluorescence levels were measured in the cellulose pellet fractions (Figure 5). We observed that the fluorescence levels in the cellulose pellet incubated with Cerberus protein clicked to FITC were about 3 times higher than in the control experiments corresponding to the cellulose pellet incubated with FITC alone. These results show that Cerberus can efficiently be conjugated with fluorescent molecules bearing a DBCO group by click chemistry and that the resulting fluorescent molecules strongly interact with cellulose.This result proves that cerberus AzF and CBM3a heads are valid and therefore, makes our construction both a practical and potent platform to functionalize cellulose.</p>
-<div class="center">
-        <div class="thumb tnone">
-            <div class="thumbinner" style="width:50%;">
-                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" class="image">
-                    <img alt="" src="/wiki/images/e/e2/T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
-                    <div class="magnify">
-                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" class="internal" title="Enlarge"></a>
-                    </div>
-                    <b>Figure 5: </b> <b>Fluorescence remaining in cellulose fraction after several washes  </b>
-                    Experiment were performed in quadruplicate test in 50 mM Tris HCl pH 8 using 100&mu;L of 10mg/ml Regenerated Amorphous Cellulose and 100&mu;L of click reaction. Samples were incubated for 30 minutes, centrifugated, supernatant discarted and resuspended in Tris HCl four times , *Mann Whitney test p-value 0.03 computed using R 3.4.2.
-                </div>
-            </div>
-        </div>
-    </div>
-<h4>Validation of the Streptavidin and CBM3a heads</h4>
-<p>To asses the functionality of the Streptavidin head, we used a non AzF version of Cerberus (its Orthos version). We performed SPAAC reaction to ligate <em>in vitro</em> biotin-DBCO to an azide-functionalized fluorescein (FITC), thus leading to the expected biotinylated FITC. 5.8 &mu;M of Orthos were incubated with 58.0 &mu;M of biotinylated FITC for one hour under shaking and then incubated with regenerated amorphous cellulose as described previously. Fluorescence was measured after four washes and results are presented in figure 6.</p>
-<div class="center">
-        <div class="thumb tnone">
-            <div class="thumbinner" style="width:50%;">
-                <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Collaborations--angeline--FluoRetainedOrthos2.jpg" class="image">
-                    <img alt="" src="https://static.igem.org/mediawiki/2018/5/52/T--Toulouse-INSA-UPS--Collaborations--angeline--FluoRetainedOrthos2.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
-                    <div class="magnify">
-                        <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Collaborations--angeline--FluoRetainedOrthos2.jpg" class="internal" title="Enlarge"></a>
-                    </div>
-                    <b>Figure 6: </b> <b>Fluorescence remaining in cellulose fraction after several washes  </b>
-                    Experiment were performed in quadruplicate test in 50 mM Tris HCl pH 8 using 100&mu;L of 10mg/ml Regenerated Amorphous Cellulose and 100&mu;L of binding reaction. Samples were incubated for 30 minutes, centrifugated, supernatant discarted and resuspended in Tris HCl four times , *Mann Whitney test p-value 0.1 computed using R 3.4.2.
-                </div>
-            </div>
-        </div>
-    </div>
-<p>The results indicates that fluorescence retained in cellulose pellet is higher when orthos is present which indicates that the binding between biotinylated FITC and Streptavidin was effective, proving that the activity of both streptavidin and CBM3 remains intact when fused. This validated the Streptavidine head.</p>
-<h4>Validation using paramagnetic beads</h4>
+<p>Figure 3 shows the enzymatic restriction pattern of the resulting clones. Clone 4 was digested using EcoRV and NdeI. Two bands were expected at 1.3 kb and 4.8 kb, as experimentally measured (lane 5).</p>
-<p> The functionality of Cerberus was further characterized using paramagnetic beads. To bind paramagnetic beads to Cerberus, we performed a click reaction using 3.2 µM of Cerberus protein and 32 µM DBCO-conjugated paramagnetic beads. In control experiment, 32 µM of paramagnetic beads were used. These samples were then incubated with cellulose, and after several washes with resuspension buffer, the magnetic capacity of cellulose using a magnet was observed and filmed (See video below). The cellulose incubated with the Cerberus protein conjugated to paramagnetic beads responded quickly and was totally collected by the magnet in contrast to the control experiment. This definitely highlights the potential of Cerberus for many applications</p>
-<div class="center">
-        <div class="thumb tnone">
-            <div class="thumbinner" style="width:80%;">
-<video controls preload="auto" muted="true" style="width : 100%; heigth = auto;" src="https://static.igem.org/mediawiki/2018/1/14/T--Toulouse-INSA-UPS--Collaborations--angeline--ferocell.MOV" alt="Magnetic cellulose">
+<div align="center">
+        <figure class="normal mx-auto">
-</video>
+            <img class="d-block"
-<div class="magnify">
+            style="width:70%;"
+            src="https://static.igem.wiki/teams/4768/wiki/registry/cloning-dhdr-part.jpg">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figure 3: Enzymatic digestion of the plasmid part</b> extracted from clone 4. Patterns from simple digestion by EcoRV or by NdeI, and double digestion by both enzymes are shown.
+</i></span></figcaption>
+        </figure>
+</i>
 </div>
-<br/>
-<b>Figure 7: </b> <b>Video of Cellulose functionnalised with magnetic beads using Cerberus  </b>
+<p>Clone 4 was sequence verified.</p>
-Left : Negative control using Paramagnetic beads alone, Right: Cerberus-Paramagnetic beads
+<h2>Characterization</h2>
+<h3>1) Production and purification of DhdR</h3>
+<p>The pET21a(+) vector including the <i>dhdR</i> insert was transformed into <i>E. coli</i> strain BL21 (DE3). This strain was provided by Cédric Montanier (researcher at TBI). When DO reaches 0.5-0.6, expression of the recombinant protein was induced overnight at 16°C using IPTG. The His-tagged protein was then purified on TALON® Metal Affinity Resin. Pure fractions were assessed by SDS-PAGE. Results are shown in Figure 4.</p>
+<div align="center">
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/module-2/gel-dhdr-wiki.jpg">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figure 4: SDS-PAGE analysis of the different steps of the DhdR purification:</b> protein ladder (SE250 Mighty Small II Mini Vertical Protein Electrophoresis Unit), pellet DhdR, cell-free extract (CFE), flowthrough (FT), wash (W), elution with 50 mM imidazole, 100 mM imidazole, 250 mM imidazole and 500 mM imidazole (respectively E1<sub>50</sub>, E1<sub>100</sub>, E1<sub>250</sub> and E1<sub>500</sub>). The band corresponding to the protein was clearly identified by Coomassie Blue staining.
+</i></span></figcaption>
+</figure>
 </div>
+<p>The expected size for DhdR is 28.27 kDa. Clear bands were observed for the four elution fractions E1<sub>50</sub>, E1<sub>100</sub>, E1<sub>250</sub> and E1 500, but not in the negative control sample, as expected. These data show that DhdR was efficiently purified and can be used for subsequent assays.<p/>
+<p>The E1<sub>250</sub> fraction was dialysed leading to a concentration of 14.4 µM (> 95% pure protein). Fractions E1<sub>100</sub> and E1<sub>500</sub> were pooled and dialysed, resulting in a concentration of 7.63 µM (> 95% pure protein).</p>
+<h3>2) Functionality tests in PURE system </h3>
+<p>The aim of the experiments was to establish that the binding of the repressor DhdR to its operator site, <i>dhdO</i>, effectively inhibits transcription of a gene of interest regulated by <i>dhdO</i>. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system (GeneFrontier).</p>
+<p>Inhibition was tested on the <i>sfgfp</i> reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. The biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.</p>
+<div align="center">
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/module-2/dhdr-results-2.jpg">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figure 5: Effect of different concentrations of DhdR on the expression of a fluorescent reporter gene.</b> Experiments 1 and 2 were performed with the same batch of PCR product from clone 8, while a new batch of PCR product from the same clone was used in experiment 3. PUREfrex2.0 was used in all conditions. The intensity value of sfGFP without DhdR was used for normalization. Excitation and emission wavelengths were 488 nm and 510 nm, respectively.
+</i></span></figcaption>
+</figure>
 </div>
+<p>As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 5). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a <i>dhdO</i> operator sequence  was 1.5 µM, validating the predictions of the biochemical network model.</p>
+<p>Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 6). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.</p>
+<div align="center">
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/module-2/dhdr-results-4.jpg">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figure 6: Effect of different concentrations of 2-HG on DhdR repression.</b> PUREfrex2.1 was used. The intensity value of sfGFP without DhdR and with 10 µM 2-HG was used for normalization. Each concentration was corrected taking into account the inactivation effect of 2-HG on PURE system.
+</i></span></figcaption>
+</figure>
 </div>
-</div>
-<h2>Conclusion and Perspectives</h2>
-<p>These results show that Cerberus has the ability to interact simultaneously with cellulose and molecules with DBCO group or biotinylated compounds. This allows multiple possibilities to functionalize cellulose through its linker containing unnatural amino acid (AzF) and/or the linker presenting the engineered monomeric Streptavidin (mSA2). </p>
-<p>Fixation of various compounds that can be chemically functionalized can now be achieved envisioning endless possibilities to functionalize cellulose. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details</p>
+<h3>3) In-liposome expression of the <i>sfgfp</i> gene</h3>
+<ul>
+    <li><b> DhdR repression in liposomes</b></li>
+<p>Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the <i>sfgfp</i> gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.</p>
+<p>Figure 7a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 7b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (no sfGFP expressed) (Fig. 7c).</p>
-==Toulouse_INSA-UPS’s 2023 Xxxxxxxxxxxxx==
+<div align="center">
-===Xxxxxxx. ===
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/module-2/microscope-1.jpg">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figures 7:</b> a) Liposomes were localized with a fluorescent membrane dye. b) Zoom-in image of the liposome area depicted with a red arrow on fig. 7a. A yellow line crossing the liposome has been appended. c) Fluorescence intensity profile along the line appended in b. The two peaks correspond to the two regions of membrane crossing.
+</i></span></figcaption>
+</figure>
+</div>
-coucou Koloina</p>
+<p>Figure 8a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 8b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 8c. </p>
-<br/>
-<html>
+<div align="center">
-<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
+        <figure class="normal mx-auto">
-</html>
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/module-2/microscope-2.jpg">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figures 8: Fluorescence microscopy image of  liposomes in the GFP channel.</b> Expressed sfGFP signal was localized in the liposome lumen. a) Large field-of-view. b) Blow-up of the liposome depicted with the red arrow in a. c) Intensity profile along the yellow line appended in b.
+</i></span></figcaption>
+</figure>
+</div>
+<p>Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes.</p>
+    <li><b> Liposomes are capable of expressing GFP in the presence of living cancer cells</b></li>
+<p>Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the <i>sfgfp</i> gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated at 37°C for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for <i>in situ</i> gene expression (sample 2). The latter protocol more closely mimics the <i>in vivo</i> conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.
+<p>In sample 1, in the field of view displayed in Figures 9, two liposomes were localized using the fluorescent membrane dye (Fig. 9b) but only one exhibits sfGFP signal (Fig. 9c).</p>
+<div align="center">
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/best-measurement/figure4bis.png">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figures 9: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 1).</b> a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of liposomes localized with a fluorescent membrane dye. c) Imaging of liposomes in the GFP channel.
+</i></span></figcaption>
+</figure>
+</div>
+<p>Similar results were obtained with sample 2, as shown in Figures 10.</p>
+<div align="center">
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/registry/part-dhdr-fig-9.png">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figures 10: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 2).</b> a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of a liposome localized with a fluorescent membrane dye. c) Imaging of the same liposome in the GFP channel.
+</i></span></figcaption>
+</figure>
+</div>
+<p>No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.</p>
+</ul>
+<h2>Molecular Modeling</h2>
+<h3>1) Model-driven feasibility assessment of the 2-HG biosensor</h3>
+<p>The impact of DhdR on cell-free expression was modeled through a set of differential equations inspired from iGEM Teams Duke 2021 and Delft 2021, and implemented on  <a href="https://gitlab.igem.org/2023/toulouse-insa-ups/-/tree/main/CALIPSO_model/Pre-calibration?ref_type=heads">COPAS v(4.38).</a></p>
+<p>The responsiveness of the anticancer liposome to a tumoral environment is a key design feature for limiting toxic side-effects. We thus used the model to evaluate whether 5-FU was produced at higher concentration in the presence of 2-HG (synthesized by cancer cells) compared to its absence. In absence of 2-HG, we expect the expression of TYPH to be repressed and, therefore, only a small amount of 5-FU would be produced. Consistently, simulations shown in Fig. 3 predicted that 1.5 μM of DhdR repressed gene expression, resulting in a ~2-fold lower concentration of 5-FU outside the liposome. Adding 100 μM of 2-HG, corresponding to typical concentrations in surrounding tumors <a href=”https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7533892/”>[2]</a>, derepressed the system and boosted 5-FU production. The model therefore met the behavior expected for liposomes and confirmed that the targeted drug production strategy could help tackle adverse effects of current chemotherapies.</p>
+<div align="center">
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/modeling/figure-3.jpg">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figure 11: Concentration of 5-FU after 6 hours in presence or absence of DhdR and 2-HG</b> (concentrations are as indicated), with an initial Tegafur concentration of 1000 μM.
+</i></span></figcaption>
+</figure>
+</div>
+<h3> 2) Guiding experiments and validating the model </h3>
+<p>We used the model to determine the optimal concentration of DhdR to be encapsulated in the liposome. To that aim, we built a reduced model containing only the biosensing and gene expression modules, along with a gene encoding the sfGFP protein that was used in the experiments as a reporter. To verify model predictions, we carried out the same experiments as done in silico using the same concentration range of DhdR and 2-HG. </p>
+<p>A gradual decrease in the fluorescence intensity, i.e., in the expression of <i>sfgfp</i>, was experimentally verified when increasing the concentration of DhdR. Importantly, measurements are consistent with the model predictions qualitatively, confirming the parameter values and structure of the model.</p>
+<p>Experimental results confirm that increasing 2-HG concentration progressively lifts the repression caused by DhdR. However, the model poorly predicted the gradual increase of sfGFP levels measured experimentally, as it was more sensitive to lower concentrations of 2HG.</p>
+<p>We thus decided to use measurements to refine the model. We estimated the values of different parameters of the biosensing module (k<sub>D2</sub>, k<sub>-D2</sub>, k<sub>D0</sub>, k<sub>-D0</sub>, k<sub>DH</sub> and k<sub>-DH</sub>) by fitting the experimental data. In comparison to the predictions of the <i>ab initio</i> model constructed from the literature, the simulations with the refined parameter values were in quantitative agreement with measurements. Importantly, the refined model with the calibrated biosensor module was also able to accurately simulate protein expression levels in the presence of 2-HG, corroborating its improved predictive power (Fig. 11). You can find the program used in the <a href="https://gitlab.igem.org/2023/toulouse-insa-ups/-/tree/main/CALIPSO_model/Post-calibration?ref_type=heads" target="blank">post-calibration Gitlab folder</a></p>.
+<div align="center">
+        <figure class="normal mx-auto">
+            <img class="d-block"
+            style="width:90%;"
+            src="https://static.igem.wiki/teams/4768/wiki/registry/figab-modelo-dhdr-part.png">
+            <figcaption class="normal"><span class="titre-image"><i><b>Figures 12: Comparison of the predictive capabilities of the kinetic model before (in pink) and after calibration (in green) using experimental data as inputs (in red).</b> (A) Concentrations of DhdR were as indicated and 2-HG was not present. (B) Concentration of DhdR was fixed to 1.5 µM and different concentrations of 2-HG were used as indicated.
+</i></span></figcaption>
+</figure>
+</div>
+<h2>Conclusion and Perspectives</h2>
+<p>These experiments provide evidence that the 2-HG biosensor that relies on the part BBa_K4768000 is functional in bulk reactions at concentrations of oncometabolite that are physiologically relevant. The biochemical network model was used to predict DhdR concentrations, and then optimized according to experimental results. Moreover,we established a protocol for encapsulating DhdR, the expression product of the part BBa_K4768000, inside liposomes. Although DhdR-based repression was not clearly demonstrated in vesicles, we gave recommendations and provided image analysis tools for future investigations.</p>
+<p>This construction can be manipulated in a Biosafety level 1 laboratory.</p>
 <h2>References</h2>
 <ol>
      <i>
-     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+     <li>Xiao, D., Zhang, W., Guo, W., Liu, Y., Hu, C., Guo, S., Kang, Z., Xu, X., Ma, C., Gao, C., & Xu, P. 2021. A D-2-hydroxyglutarate biosensor based on  specific transcriptional regulator DhdR. Nature Communications 12, 7108. </li>
-    <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+     <li>Jezek, P. 2020. 2-Hydroxyglutarate in Cancer Cells. Antioxid Redox Signal, 33(13),903-926.</li>
-     <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
 </i>
 </ol>
 </html>
-<!-- Add more about the biology of this part here
-===Usage and Biology===
-<!-- -->
-<!-- Uncomment this to enable Functional Parameter display
-===Functional Parameters===
-<partinfo>BBa_K2668010 parameters</partinfo>
-<!-- -->