Difference between revisions of "Part:BBa K203100:Design"

(→‎References)
(→‎Design Notes)
 
(2 intermediate revisions by the same user not shown)
Line 7: Line 7:
 
===Design Notes===
 
===Design Notes===
 
As a starting plasmid, we used pcDNA5/FRT (Invitrogen), as having this plasmid at hand was an immediate requirement for our project and we did not have the time to construct it from parts. We nevertheless highly modified it by performing two site-directed mutageneses to remove prohibited cutsites, we removed the CMV promoter it contained and inserted JeT, a well-described[1] synthetic promoter which we modified to contain a HindIII cutsite between the proximal and the core promoter for promoter screening. We also added full BBB_2 (Tom Knight) sites to it. Then, we synthesized it by Assembly PCR and inserted it via a MfeI and a PstI site. We then fixed eGFP plus a Kozak-sequence (eukaryotic RBS) into the plasmid backbone by cutting with PstI and BClI
 
As a starting plasmid, we used pcDNA5/FRT (Invitrogen), as having this plasmid at hand was an immediate requirement for our project and we did not have the time to construct it from parts. We nevertheless highly modified it by performing two site-directed mutageneses to remove prohibited cutsites, we removed the CMV promoter it contained and inserted JeT, a well-described[1] synthetic promoter which we modified to contain a HindIII cutsite between the proximal and the core promoter for promoter screening. We also added full BBB_2 (Tom Knight) sites to it. Then, we synthesized it by Assembly PCR and inserted it via a MfeI and a PstI site. We then fixed eGFP plus a Kozak-sequence (eukaryotic RBS) into the plasmid backbone by cutting with PstI and BClI
 +
 +
Note: The promoter that is measured can be sequenced by using CCCCTATGGTGCACTCTCAG as a primer.
 +
 +
[[Image:P31_cloning_smaller.png]]
  
 
===Source===
 
===Source===
  
−
plasmid: modified from pcDNA5/FRT (Invitrogen) as described below
+
plasmid: modified from pcDNA5/FRT (Invitrogen) as described above
 
GFP: PCR from a plasmid containing eGFP-N1
 
GFP: PCR from a plasmid containing eGFP-N1
  

Latest revision as of 23:06, 21 October 2009

pSMB_MEASURE: Promoter Measurement plasmid (mammalian)


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 171
    Illegal XbaI site found at 1655
    Illegal SpeI site found at 185
    Illegal PstI site found at 375
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal prefix found at 171
    Plasmid lacks a suffix.
    Illegal NheI site found at 361
    Illegal PstI site found at 375
    Illegal NotI site found at 367
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 171
    Illegal BglII site found at 12
  • 23
    INCOMPATIBLE WITH RFC[23]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 171
    Illegal XbaI site found at 1655
    Illegal SpeI site found at 185
    Illegal PstI site found at 375
  • 25
    INCOMPATIBLE WITH RFC[25]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 171
    Illegal XbaI site found at 1655
    Illegal SpeI site found at 185
    Illegal PstI site found at 375
    Illegal NgoMIV site found at 1515
    Illegal NgoMIV site found at 2778
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal BsaI.rc site found at 4306
    Illegal SapI site found at 3223


Design Notes

As a starting plasmid, we used pcDNA5/FRT (Invitrogen), as having this plasmid at hand was an immediate requirement for our project and we did not have the time to construct it from parts. We nevertheless highly modified it by performing two site-directed mutageneses to remove prohibited cutsites, we removed the CMV promoter it contained and inserted JeT, a well-described[1] synthetic promoter which we modified to contain a HindIII cutsite between the proximal and the core promoter for promoter screening. We also added full BBB_2 (Tom Knight) sites to it. Then, we synthesized it by Assembly PCR and inserted it via a MfeI and a PstI site. We then fixed eGFP plus a Kozak-sequence (eukaryotic RBS) into the plasmid backbone by cutting with PstI and BClI

Note: The promoter that is measured can be sequenced by using CCCCTATGGTGCACTCTCAG as a primer.

P31 cloning smaller.png

Source

plasmid: modified from pcDNA5/FRT (Invitrogen) as described above GFP: PCR from a plasmid containing eGFP-N1

References

[1] Tornoe, J. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites. Gene 297, 21-32 (2002).