Difference between revisions of "Part:BBa K203100:Design"
(→Design Notes) |
|||
(4 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K203100 short</partinfo> | <partinfo>BBa_K203100 short</partinfo> | ||
Line 9: | Line 8: | ||
As a starting plasmid, we used pcDNA5/FRT (Invitrogen), as having this plasmid at hand was an immediate requirement for our project and we did not have the time to construct it from parts. We nevertheless highly modified it by performing two site-directed mutageneses to remove prohibited cutsites, we removed the CMV promoter it contained and inserted JeT, a well-described[1] synthetic promoter which we modified to contain a HindIII cutsite between the proximal and the core promoter for promoter screening. We also added full BBB_2 (Tom Knight) sites to it. Then, we synthesized it by Assembly PCR and inserted it via a MfeI and a PstI site. We then fixed eGFP plus a Kozak-sequence (eukaryotic RBS) into the plasmid backbone by cutting with PstI and BClI | As a starting plasmid, we used pcDNA5/FRT (Invitrogen), as having this plasmid at hand was an immediate requirement for our project and we did not have the time to construct it from parts. We nevertheless highly modified it by performing two site-directed mutageneses to remove prohibited cutsites, we removed the CMV promoter it contained and inserted JeT, a well-described[1] synthetic promoter which we modified to contain a HindIII cutsite between the proximal and the core promoter for promoter screening. We also added full BBB_2 (Tom Knight) sites to it. Then, we synthesized it by Assembly PCR and inserted it via a MfeI and a PstI site. We then fixed eGFP plus a Kozak-sequence (eukaryotic RBS) into the plasmid backbone by cutting with PstI and BClI | ||
− | + | Note: The promoter that is measured can be sequenced by using CCCCTATGGTGCACTCTCAG as a primer. | |
− | + | ||
+ | [[Image:P31_cloning_smaller.png]] | ||
===Source=== | ===Source=== | ||
− | plasmid: modified from pcDNA5/FRT (Invitrogen) as described | + | plasmid: modified from pcDNA5/FRT (Invitrogen) as described above |
GFP: PCR from a plasmid containing eGFP-N1 | GFP: PCR from a plasmid containing eGFP-N1 | ||
===References=== | ===References=== | ||
+ | |||
+ | [1] Tornoe, J. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites. Gene 297, 21-32 (2002). |
Latest revision as of 23:06, 21 October 2009
pSMB_MEASURE: Promoter Measurement plasmid (mammalian)
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 171
Illegal XbaI site found at 1655
Illegal SpeI site found at 185
Illegal PstI site found at 375 - 12INCOMPATIBLE WITH RFC[12]Illegal prefix found at 171
Plasmid lacks a suffix.
Illegal NheI site found at 361
Illegal PstI site found at 375
Illegal NotI site found at 367 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 171
Illegal BglII site found at 12 - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 171
Illegal XbaI site found at 1655
Illegal SpeI site found at 185
Illegal PstI site found at 375 - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 171
Illegal XbaI site found at 1655
Illegal SpeI site found at 185
Illegal PstI site found at 375
Illegal NgoMIV site found at 1515
Illegal NgoMIV site found at 2778 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI.rc site found at 4306
Illegal SapI site found at 3223
Design Notes
As a starting plasmid, we used pcDNA5/FRT (Invitrogen), as having this plasmid at hand was an immediate requirement for our project and we did not have the time to construct it from parts. We nevertheless highly modified it by performing two site-directed mutageneses to remove prohibited cutsites, we removed the CMV promoter it contained and inserted JeT, a well-described[1] synthetic promoter which we modified to contain a HindIII cutsite between the proximal and the core promoter for promoter screening. We also added full BBB_2 (Tom Knight) sites to it. Then, we synthesized it by Assembly PCR and inserted it via a MfeI and a PstI site. We then fixed eGFP plus a Kozak-sequence (eukaryotic RBS) into the plasmid backbone by cutting with PstI and BClI
Note: The promoter that is measured can be sequenced by using CCCCTATGGTGCACTCTCAG as a primer.
Source
plasmid: modified from pcDNA5/FRT (Invitrogen) as described above GFP: PCR from a plasmid containing eGFP-N1
References
[1] Tornoe, J. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites. Gene 297, 21-32 (2002).