Difference between revisions of "Part:BBa K4317099"
(4 intermediate revisions by the same user not shown) | |||
Line 4: | Line 4: | ||
This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099) | This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099) | ||
+ | |||
+ | =BBa_K4317099= | ||
+ | |||
+ | https://static.igem.org/mediawiki/parts/thumb/a/ad/SP_libray.png/800px-SP_libray.png | ||
+ | |||
+ | =AIO t-vector-BBa_K4317099= | ||
+ | |||
+ | https://static.igem.org/mediawiki/parts/thumb/d/df/Secretion_signal_library-tvector.png/644px-Secretion_signal_library-tvector.png | ||
+ | |||
+ | =PCR product= | ||
https://static.igem.org/mediawiki/parts/thumb/6/6a/Secretion_signal_library.png/800px-Secretion_signal_library.png | https://static.igem.org/mediawiki/parts/thumb/6/6a/Secretion_signal_library.png/800px-Secretion_signal_library.png | ||
Line 13: | Line 23: | ||
https://static.igem.org/mediawiki/parts/thumb/2/27/Library_PCR.png/529px-Library_PCR.png | https://static.igem.org/mediawiki/parts/thumb/2/27/Library_PCR.png/529px-Library_PCR.png | ||
− | Figure | + | Figure 2. PCR product containing the signal peptide library |
https://static.igem.org/mediawiki/parts/thumb/d/dd/Re.png/452px-Re.png | https://static.igem.org/mediawiki/parts/thumb/d/dd/Re.png/452px-Re.png | ||
− | Figure | + | Figure 3. secretion signal fragments digested by NdeI, NcoI |
+ | https://static.igem.org/mediawiki/parts/thumb/9/95/Page.png/800px-Page.png | ||
+ | Figure 4. SDS-PAGE and western blot of cellulose-degrading enzymes secreted from B. subtilis and E. coli | ||
− | + | The combination of 16 secretion signals and enzymes found previously was subcloned using the IPTG inducible system. These plasmids were transformed into Bacillus 1A976 and E. coli BL21 and filtered with a 0.2um CA syringe filter after induction with IPTG. Each sample was separated by size through SDS-PAGE. The resolved protein was transferred to a 0.45um PVDF membrane and then immunoblotted with an anti-his tag antibody. Finally, the blotted membrane was stained with amido black | |
− | + | ||
==Sequence and Features== | ==Sequence and Features== | ||
<partinfo>BBa_K4317099 SequenceAndFeatures</partinfo> | <partinfo>BBa_K4317099 SequenceAndFeatures</partinfo> |
Latest revision as of 13:53, 12 October 2022
Secretion signal library
This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099)
BBa_K4317099
AIO t-vector-BBa_K4317099
PCR product
Usage and Biology
We did not digest the plasmid DNA directly with NdeI or NcoI, but cut the library part after amplification using the primers (AIO F- GGATAACCGTATTACCGCCT TTGAG, AIO R- CACAAACAGACGATAACGGCTCTC) shown in Fig. 1 (Fig. 2, 3). Secretion signal fragments were ligated with the DNA fragments coding for each enzyme with Bacillus and E. coli expression vectors and transformed (Fig. 4).
Figure 2. PCR product containing the signal peptide library
Figure 3. secretion signal fragments digested by NdeI, NcoI
Figure 4. SDS-PAGE and western blot of cellulose-degrading enzymes secreted from B. subtilis and E. coli
The combination of 16 secretion signals and enzymes found previously was subcloned using the IPTG inducible system. These plasmids were transformed into Bacillus 1A976 and E. coli BL21 and filtered with a 0.2um CA syringe filter after induction with IPTG. Each sample was separated by size through SDS-PAGE. The resolved protein was transferred to a 0.45um PVDF membrane and then immunoblotted with an anti-his tag antibody. Finally, the blotted membrane was stained with amido black
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 820
- 1000COMPATIBLE WITH RFC[1000]