Difference between revisions of "Part:BBa K4441004"
(→Alternative Sequence) |
|||
(4 intermediate revisions by the same user not shown) | |||
Line 7: | Line 7: | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
This is the sequence for the outer forward primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the BRAF V600E: | This is the sequence for the outer forward primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the BRAF V600E: | ||
− | + | TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGA | |
+ | GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT | ||
+ | GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG | ||
− | Dilutions | + | ====Dilutions==== |
Storage Primer Concentration: 100 μM | Storage Primer Concentration: 100 μM | ||
Line 24: | Line 26: | ||
1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington | 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington | ||
+ | ====Alternative Sequence==== | ||
+ | As this set of primer failed to produce a positive result, we used NEB LAMP Primer Design Tool (https://lamp.neb.com/#!/) to generate an alternative set of primers. Unfortunately, due to time and budgetary constraints, these primers have not been ordered and experimented with yet. | ||
+ | |||
+ | Sequence: TACACGCCAAGTCAATCA | ||
+ | |||
+ | 5′ pos: 6 | ||
+ | |||
+ | 3′ pos: 23 | ||
+ | |||
+ | len: 18 | ||
+ | |||
+ | Tm: 55.35 | ||
+ | |||
+ | 5′ dG: -5.07 | ||
+ | |||
+ | 3′ dG: -4.07 | ||
+ | |||
+ | % GC: 44 | ||
==Citations== | ==Citations== |
Latest revision as of 05:28, 12 October 2022
BRAF V600E F3
Sequence used in wetlab experiments: GGAAAATGAGATCTACTG is taken from [1]
Usage and Biology
This is the sequence for the outer forward primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the BRAF V600E: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGA GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG
Dilutions
Storage Primer Concentration: 100 μM
10X Concentration (Stock): 16 μM
Volume of 10X primer mix: 10 μL
1X Concentration (Final):1.6 μM
Volume of storage primer needed: 0.2 μL
Mixed with B3, FIP, BIP, LF and LB for a total of 4.4 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington
Alternative Sequence
As this set of primer failed to produce a positive result, we used NEB LAMP Primer Design Tool (https://lamp.neb.com/#!/) to generate an alternative set of primers. Unfortunately, due to time and budgetary constraints, these primers have not been ordered and experimented with yet.
Sequence: TACACGCCAAGTCAATCA
5′ pos: 6
3′ pos: 23
len: 18
Tm: 55.35
5′ dG: -5.07
3′ dG: -4.07
% GC: 44
Citations
1. Papadakis, G., Pantazis, A. K., Fikas, N., Chatziioannidou, S., Tsiakalou, V., Michaelidou, K., ... & Gizeli, E. (2022). Portable real-time colorimetric LAMP-device for rapid quantitative detection of nucleic acids in crude samples. Scientific reports, 12(1), 1-15.
2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 9
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]