Difference between revisions of "Part:BBa K4441000"
(→Usage and Biology) |
|||
(8 intermediate revisions by the same user not shown) | |||
Line 5: | Line 5: | ||
Sequence used in wetlab experiments: CCACAGAGACCTCAAGAGT is taken from [1] | Sequence used in wetlab experiments: CCACAGAGACCTCAAGAGT is taken from [1] | ||
− | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
− | This is the sequence for the | + | This is the sequence for the Outer Forward Primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the WT BRAF: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGA |
+ | GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT | ||
+ | GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG | ||
+ | |||
+ | ====Dilutions==== | ||
+ | |||
+ | Storage Primer Concentration: 100 μM | ||
+ | |||
+ | 10X Concentration (Stock): 16 μM | ||
+ | |||
+ | Volume of 10X primer mix: 10 μL | ||
+ | |||
+ | 1X Concentration (Final): 1.6 μM | ||
+ | |||
+ | Volume of storage primer needed: 0.2 μL | ||
+ | |||
+ | Mixed with B3, FIP, BIP for a total of 3.6 μL -- Final primer mix | ||
+ | 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington | ||
==Citations== | ==Citations== | ||
1. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996. | 1. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996. | ||
+ | |||
2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html | 2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html | ||
+ | |||
<!-- --> | <!-- --> | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> |
Latest revision as of 05:33, 12 October 2022
BRAF WT F3
Sequence used in wetlab experiments: CCACAGAGACCTCAAGAGT is taken from [1]
Usage and Biology
This is the sequence for the Outer Forward Primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the WT BRAF: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGA GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG
Dilutions
Storage Primer Concentration: 100 μM
10X Concentration (Stock): 16 μM
Volume of 10X primer mix: 10 μL
1X Concentration (Final): 1.6 μM
Volume of storage primer needed: 0.2 μL
Mixed with B3, FIP, BIP for a total of 3.6 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington
Citations
1. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996.
2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]