Difference between revisions of "Part:BBa K4491007"

 
(71 intermediate revisions by the same user not shown)
Line 2: Line 2:
 
<partinfo>BBa_K4491007 short</partinfo>
 
<partinfo>BBa_K4491007 short</partinfo>
 
{| style="color:black" cellpadding="6" cellspacing="1" border="2" align="right"
 
{| style="color:black" cellpadding="6" cellspacing="1" border="2" align="right"
! colspan="2" style="background:#00FF00;"|araBAD promoter
+
! colspan="2" style="background:#00FF00;"|pBAD_AP
 
|-
 
|-
 
|'''Function'''
 
|'''Function'''
 
|Inducible promoter
 
|Inducible promoter
|-
 
|'''Use in'''
 
|Bacterial
 
 
|-
 
|-
 
|'''Chassis Tested'''
 
|'''Chassis Tested'''
|Escherichia coli
+
|Escherichia coli (bacterial)
 +
|-
 +
|'''Assembly Used'''
 +
|JUMP Assembly
 
|-
 
|-
 
|'''Abstraction Hierarchy'''
 
|'''Abstraction Hierarchy'''
Line 26: Line 26:
 
|}
 
|}
  
This gene encodes an improved version of the wild-type araBAD promoter (nicknamed pBAD), an inducible promoter controlled by araC protein. The native pBAD is part of the araBAD operon, which is responsible for regulating arabinose metabolism in E.coli.
+
This gene encodes an improved version of the wild-type araBAD promoter called pBAD_AP2, an inducible promoter controlled by araC protein. The native pBAD is part of the araBAD operon, which is responsible for regulating arabinose metabolism in E.coli.
 +
pBAD_AP2 belongs to a collection of newly-designed araBAD promoters that are <b>below 160 bp!</b> <b> As the Registry does not generally allow an entry with multiple sequences, we gave the sequence of pBAD_AP2 only as a representative (shows significant improvement), but all remaining sequences are also given below for completeness </b>.  
  
 
<html>
 
<html>
Line 51: Line 52:
  
 
=== pBAD Entries in the Registry===
 
=== pBAD Entries in the Registry===
TBA
+
Our team essentially created a family of combinatorial pBADs, some of which yielded significant improvement from the wild-type version. We list below several previous entries of the araBAD promoters, some of which may offer stronger merits in certain aspects. All of our designs have a truncated length of less than 160 base pairs, which is only half of the typical size.
  
=== Preamble from Cambridge team ===
+
* [https://parts.igem.org/Part:BBa_K2442101 BBa_K2442101] by team Glasgow 2017
 +
* [https://parts.igem.org/PBAD_SPL PBAD_SPL] by team Denmark DTU 2013.
 +
* [https://parts.igem.org/PBAD_Promoter_Family PBAD_Promoter_Family] by team British Columbia 2009.
 +
 
 +
=== Preamble from the Cambridge team ===
  
 
The Cambridge 2022 Team had intended to use the araBAD promoter to build an antithetic feedback circuit that demonstrates robust perfect adaptation (RPA). However, we were concerned that wild-type PBAD is relatively large, topping at around 300 bp, which increases the bulkiness of our Level-2 construct and reduces efficiency. Also, pBAD, by nature, is a relatively leaky and medium-strength promoter, therefore, lots of araC is needed to fully reach maximal activation. However, overexpression of araC is toxic to cells, and thus can drastically impede performance of the circuit.
 
The Cambridge 2022 Team had intended to use the araBAD promoter to build an antithetic feedback circuit that demonstrates robust perfect adaptation (RPA). However, we were concerned that wild-type PBAD is relatively large, topping at around 300 bp, which increases the bulkiness of our Level-2 construct and reduces efficiency. Also, pBAD, by nature, is a relatively leaky and medium-strength promoter, therefore, lots of araC is needed to fully reach maximal activation. However, overexpression of araC is toxic to cells, and thus can drastically impede performance of the circuit.
we therefore thought it would be an interesting Part Improvement project to redesign the existing wild-type promoter. Our initial goal was to engineer a PBAD with minimal length, but shows both lower leakiness and higher maximal activity. To achieve this, we did intensive literature search for prior optimization strategies. To understand the rationales, we also gathered information on the regulatory mechanism of the promoter, which was presumably only prevalent in papers from the 1970s.  
+
we therefore thought it would be an interesting Part Improvement project to redesign the existing wild-type promoter. Our initial goal was to engineer a PBAD with <b>minimal length</b>, but shows both lower leakiness and higher maximal activity. To achieve this, we did intensive literature search for prior optimization strategies. To understand the rationales, we also gathered information on the regulatory mechanism of the promoter, which was presumably only prevalent in papers from the 1970s.  
  
 +
We envisioned that the significant reduction in the promoter’s size can be of frugal advantage for future circuit designs. With less than 150 bp, the promoter can be synthesised by oligo-annealing, which is significantly faster and cheaper than ordering DNA parts. This could also be of great benefit for future iGEM teams from regions where DNA synthesis and delivery are often slow, allowing them to speed up project timelines.
  
=== Design rationales ===
+
=== pBAD_AP sequences ===
Understanding the overall mechanism of araBAD promoter allowed us to pinpoint several aspects of the structure that can be rationally improved.
+
  
==== Rationale 1: Spacing between araI1 - araO2 ====
+
The table below shows nine newly-designed araBAD promoters, all with less than 160 base pairs.
To minimise the length of pBAD, we investigated the presence of araO2 site, as well as the 211 bp spacer between araI1 and araO2 (this region includes CAP binding sites and araO1). Previous literature suggested that complete or even partial deletions of araO2 would increase leaky expression of pBAD, emphasising that the existence of this region is essential for normal repression. Strangely, most commercially available sequences for pBAD (in CIDAR MoClo kit, for example) omitted the araO2 site, so its significance is still uncertain.
+
To see our design rationales for all sequences, please check out the Design page.
  
The spacing will dictate the size of the loop, which also controls the level of repression under the absence of arabinose and determines the promoter’s leakiness. Here, the spacing is defined to be between position -59 within araI1 and -270 within araO2 (underlined and asterisked). It was shown that there are no lower bounds for loop size - a functional araBAD promoter was designed with a 34-bp loop, after deleting a significant portion of the spacer []. While it maintained similar leakiness to that of the wild-type counterpart, the loss of CAP binding site drastically reduced the maximal strength. Still, the finding demonstrated the great flexibility of bulky araC proteins in mediating small loop formation.
+
{| style="color:black" cellpadding="6" cellspacing="1" border="1" align="right" align="center"
 +
! style="background:#00FF00; color:black"  |Identifier<sup>a</sup>
 +
! style="background:#00FF00; color:black"  |Rationale 1<sup>b</sup>
 +
! style="background:#00FF00; color:black"  |Rationale 2
 +
! style="background:#00FF00; color:black"  |Rationale 3
 +
! colspan="2" style="background:#00FF00; color:black"  |Part sequences
  
[[File:Rationale1.png|600px|thumb|center|
+
|-
<center>'''Figure 3: Schematic representation of length modification within the araO2-araI1 spacing.'''</center>
+
|align="center"|AP1
''' ]]
+
|align="center"|+
 +
|align="center"|-
 +
|align="center"|-
 +
|<font face="Courier" size="0.1" class=">agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta
 +
cctgacgctttttatcgcaactctctactgtttctccatacccg</font>
 +
|-
 +
|align="center"|AP2
 +
|align="center"|+
 +
|align="center"|+
 +
|align="center"|-
 +
|<font face="Courier" size="0" class=">agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat
 +
cctgacgctttttatcgcaactctctactgtttctccatacccg</font>
 +
|-
 +
|align="center"|AP3
 +
|align="center"|+
 +
|align="center"|-
 +
|align="center"|+
 +
|<font face="Courier" size="0" class=">agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggat
 +
cctacctgacgctttttatcgcaactctctactgtttctccatacccg</font>
 +
|-
 +
|align="center"|AP4
 +
|align="center"|+
 +
|align="center"|+
 +
|align="center"|+
 +
|<font face="Courier" size="0" class=">agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat
 +
cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg</font>
 +
|-
 +
|align="center"|AP5
 +
|align="center"|+
 +
|align="center"|+ (78)<sup>c</sup>
 +
|align="center"|+
 +
|<font face="Courier" size="0" class=">agaaaccaattgtccatattgcatcagacattgccgtcacattgattatttgcacggcgtcacactttgctatgccatagcaagatagt
 +
ccataagattagcgtttttatcctgacgtgcgcctgccgtccaaagtaatatccttacatacccg</font>
 +
|-
 +
|align="center"|AP6
 +
|align="center"|-
 +
|align="center"|+
 +
|align="center"|-
 +
|<font face="Courier" size="0" class=">acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat
 +
cctgacgctttttatcgcaactctctactgtttctccatacccg</font>
 +
|-
 +
|align="center"|AP7
 +
|align="center"|-
 +
|align="center"|+
 +
|align="center"|+
 +
|<font face="Courier" size="0" class=">acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat
 +
cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg</font>
 +
|-
 +
|align="center"|AP8
 +
|align="center"|-
 +
|align="center"|-
 +
|align="center"|+
 +
|<font face="Courier" size="0" class=">acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta
 +
cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg</font>
 +
|-
 +
|align="center"|AP9
 +
|align="center"|-
 +
|align="center"|-
 +
|align="center"|-
 +
|<font face="Courier" size="0" class=">agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta
 +
cctgacgctttttatcgcaactctctactgtttctccatacccg</font>
 +
|}
 +
<sup>a</sup> AP refers to the initials of the principal designer of the araBAD promoters.
  
Another important observation was that as the spacing varied, the promoter activity oscillated with a 11.1 bp periodicity. Specifically, any insertion or deletion of integer multiples of 5bp noticeably increased leakiness, while integer multiples of 11.1 bp retained wild-type’s full repression [8]. This value was determined to be approximately equivalent to one helical repeat of DNA (10.5 bp). It was further explained that insertion of 5 bp between araO2 and araI1 would rotate one site halfway around the DNA double helix with respect to the other and impede repression. Despite araC’s flexibility, the torsional stress of DNA makes such looping much more energetically unfavourable.
+
<sup>b</sup>(-) in Rationale 1 refers to complete removal of both araO2 and the spacing, but still leaves the CAP binding site.
  
Taking into account these results, our first design strategy is to reduce the spacer region down to 56 bp while still maintaining the CAP binding site downstream. We removed the araO1 site completely due to its minor role on P_BAD activity. The schematic of our rationale is depicted below.
+
<sup>c</sup> AP5 has a spacing of 78 bp instead of the common 56 bp.
  
==== Rationale 2: araI1 and araI2====
+
=== Experimental design ===
We then investigated araI1 and araI2 17-bp regions, both containing two unique sites called the A- and B-box, which serve as specific binding sites for araC. In previous literature, Niland et al (1996) showed that any single base-pair substitution occurring in these two sites would drastically reduce binding of araC. Flanked between the two boxes are seven invariant nucleotides that, upon selected single substitution, demonstrated higher binding affinity to araC by somewhat 140% compared to that of wild-type araI1 []. We therefore modified the araI1 site to contain all the different substitutions which initially yielded tighter binding, while keeping the A- and B-boxes unchanged.
+
  
In another paper, Reeder (1993) found that the B-box of araI2 overlaps with four base pairs of the -35 consensus sequence [9]. Thus, any substitution in this box will negatively impact P_BAD’s activity, either resulting in very high leaky expression or lowered inducibility. However, the author remarked that araI1 has much higher affinity to araC than araI2 does, especially when no arabinose is present. This makes sense, as araC prefers binding to distal araO2 and araI1 than the nearby araI2. From this insight, we questioned whether a duplicate araI1-I1 may confer higher maximal activity than wild-type araI1-I2. We then sought to change the last nucleotide of the A-box and the interbox sequence of araI2 to that of wild-type araI1, but still leaving the araI2 B-box untouched. In a sense, we created a chimeric half-araI1-half-araI2 in place of wild-type araI2. We did not duplicate the entire araI1 as this would affect the overlapping -35 consensus sequence and make the promoter extremely leaky. 
+
To test the designed araBAD promoters, we cloned nine respective Level 0 promoter parts into Level 1 JUMP constructs, using a standard Golden Gate Assembly protocol with BsaI-HFv2. Lying downstream of the promoter is a B0032 medium RBS, an mVenus reporter and a DT5 double terminator. A medium-strength RBS was chosen to avoid burden caused by accidental overexpression of mVenus. All TUs were put into a pJUMP27-1A destination vector. The low copy number plasmid makes it favourable for avoiding phototoxicity and aggregate bodies, as well as reducing noise. A list of constructs ID and their respective constituent promoter is given below.
[[File:Rationale2.png|600px|thumb|center|
+
<center>'''Figure 4: Schematic representation of nucleotide substitutions within the araI1-araI2 region.'''</center>
+
''' ]]
+
  
We group the modifications for both araI1 and araI2 as our second strategy.
 
  
==== Rationale 3: -35 and -10 ====
+
[[File:LVL1construct.png|690px|thumb|left|
 +
<center>'''Figure 3: Schematic representation (in SBOL) of Level 1 PB constructs.'''</center>]]
 +
{| style="color:black" cellpadding="6" cellspacing="4" border="2" align="right"
 +
! style="background:#00FF00; color:black"  |LVL1 ID
 +
! style="background:#00FF00; color:black"  |Promoter
 +
|-
 +
|'''PB1'''
 +
|AP1
 +
|-
 +
|'''PB2'''
 +
|AP2
 +
|-
 +
|'''PB3'''
 +
|AP3
 +
|-
 +
|'''PB4'''
 +
|AP4
 +
|-
 +
|'''PB5'''
 +
|AP5
 +
|-
 +
|'''PB6'''
 +
|AP6
 +
|-
 +
|'''PB7'''
 +
|AP7
 +
|-
 +
|'''PB8'''
 +
|AP8
 +
|-
 +
|'''PB9'''
 +
|AP9
 +
|-
 +
|'''PB10'''
 +
|BBa_K2442101
 +
|-
 +
|'''PBneg'''
 +
|dummy control
 +
|}
 +
 
 
<p>
 
<p>
Our final design input comes from the work of the 2013 DTU iGEM team (see [https://parts.igem.org/PBAD_SPL here]). They managed to create a synthetic promoter library (SPL) for araBAD promoter by randomly mutating different base-pairs between the -35 and -10 boxes, right downstream of araI2. We decided to use the Col15 sequence, which showed promising low level of leakiness and high induced strength.  
+
Golden-gate-assembled mixtures were chemically transformed into DH5alpha cells for selection on Kanamycin plates. cPCR was carried out on seemingly-good colonies to screen for bands with correct size. Colonies with successful assemblies, indicated by cPCR, were liquid cultured for next-day miniprep. The retrieved plasmids, once verified through Sanger sequencing, were then transformed into a Marionette-Wild strain by electroporation. We chose Marionette as the testing strain because it is highly optimised as an arabinose sensor. Colonies of Marionette cells (selected on Kanamycin plates) were inoculated in 2 mL Neidhardt EZ Rich Defined Medium (EZRDM) and shaking-incubated overnight for 20 hours, at 37<sup>o</sup>C and 250 rpm.
 
</p>
 
</p>
==== Combinatorial design ====
+
 
We finally opted for a combinatorial approach for the three strategies, and thus have initially designed 23 = 8 different pBADs, with or without the preceding optimizations. After some thoughts, we introduced another design with a slightly larger spacing between araO2 and araI1 (PB5). These designs were tested against the wild-type, full-length araBAD promoter, corresponding to part [https://parts.igem.org/BBa_K2442101 BBa_K2442101] in the registry. We were aware that while an individual strategy may yield noticeable improvements, this might not be true when combining them together. In fact, some can result in antagonistic effects rather than the desired synergy. Still, we hoped that within the different permutations, some good designs may emerge. We also thought that, given this variety of promoter expression, we should not restrict our aim to only creating a single better pBAD, but also making a “family” of the promoter with different strengths, such as weak, medium and strong, for various purposes (in some cases, lower maximal activity might be necessary).
+
[[File:Marionette.png|700px|thumb|center|
 +
<center>''' Figure 4: Schematic representation of mechanism of action for LVL1 testing circuits in Marionette strain.'''</center>]]
 +
 
 +
 
 +
We conducted two experiments to validate the nine pBADs against the wild-type counterpart and a negative control. The negative control (termed PBneg) was a dummy construct with similar length, containing mVenus CDS, but no araBAD promoters. Both the wild-type (PB10) and the PBneg constructs were cloned using the method described above.
 +
 
 +
Both experiments would involve measuring mVenus fluorescence intensity (FI) of transformed Marionettes grown under varying arabinose concentrations. FI was measured using a ClarioStar plate reader, on Greiner F-bottom 96-well plates or standard Greiner 384-well plates.
 +
 
 +
=== Results ===
 +
====Two-Level factorial screen====
 +
We first investigated the leakiness and maximal strength of the eight P_BADs. We chose arabinose concentrations of 0 uM and 1000 uM as the testing conditions. We shall, for now, not take Hill’s dynamics into account, and focus solely on the two concentration endpoints that best showcase the promoters’ two characteristics. We also calculated the fold-change (or fold-induction), defined as the ratio of maximal expression to leakiness:
 +
 
 +
Fold change = Max expression / Leakiness
 +
 
 +
Each sample was done in four replicates. The raw data are plotted in Figure 5,6 and 7.
 +
 
 +
[[File:TimeFI.pdf|850px|thumb|center|
 +
<center>''' Figure 5: Time-dependent FI measurement of all PB constructs at 0uM and 1000uM arabinose concentrations.'''</center>]]
 +
 
 +
 
 +
[[File:TimeOD600.png|850px|thumb|center|
 +
<center>''' Figure 6: Time-dependent OD600 measurement showing cell growth of transformed Marionettes at 0uM and 1000uM arabinose concentrations.'''</center>]]
 +
 
 +
 
 +
[[File:AraBAD_foldchange.png|850px|thumb|center|
 +
<center>''' Figure 7: Performances (leakiness, maximal expression and fold-change) of Marionettes with different PB constructs, measured by fluorescence intensity (a.u.). The scale of the circles indicates the degree of fold-change. x-axis is leakiness, y-axis is max. expression.'''</center>]]
 +
 
 +
==== Hill's induction assay ====
 +
We also hoped to characterise classical parameters of inducible systems, namely, the dissociation constant K<sub>D</sub> and the Hill’s coefficient n. Therefore, we carried out a combinatorial induction assay with arabinose concentrations ranging from 0, 10, 25, 50, 75, 100, 125, 200, 500, 1000 and 2000 uM. For this testing, we used a 384-well plate instead to test all constructs; and a robot called Opentron OT-2 to automate plate preparation. Results are shown below.
 +
 
 +
[[File:TimeFI_Hills.png|850px|thumb|center|
 +
<center>''' Figure 8: Time-dependent FI measurement showing cell growth of transformed Marionettes under varying arabinose concentrations.'''</center>]]
 +
 
 +
[[File:TimeOD600_Hills.png|950px|thumb|center|
 +
<center>''' Figure 9: Time-dependent OD600 measurement showing cell growth of transformed Marionettes under varying arabinose concentrations.'''</center>]]
 +
 
 +
We selected PB1, PB2, PB3, PB8, PB9 and PB10 and used the template equation given in Meyer et al (2019) for least-square regression. An example plot for the fitted curve of PB10 is given in Figure 10, and the six fitted functions are collected in a single plot in Figure 11.
 +
 
 +
[[File:PB10.png|700px|thumb|center|
 +
<center>''' Figure 10: Fitted Hill’s function of PB10 (containing wild-type P_BAD) under varying arabinose concentrations.'''</center>]]
 +
 
 +
[[File:fitted.png|700px|thumb|center|
 +
<center>''' Figure 11: Fitted Hill’s functions of selected PB constructs (PB1, PB2, PB3, PB8, PB9 and PB10) under varying arabinose concentrations.'''</center>]]
 +
 
 +
{| style="color:black" cellpadding="6" cellspacing="2" border="2" align="center"
 +
! style="background:#00FF00; color:black"  |LVL1 ID
 +
! style="background:#00FF00; color:black"  |K<sub>D</sub> (uM) (fitted)
 +
! style="background:#00FF00; color:black"  |Hill's coefficient n (fitted)
 +
|-
 +
|'''PB1'''
 +
|29.6
 +
|0.54
 +
|-
 +
|'''PB2'''
 +
|31.1
 +
|0.56
 +
|-
 +
|'''PB3'''
 +
|32.9
 +
|0.54
 +
|-
 +
|'''PB8'''
 +
|64.5
 +
|0.63
 +
|-
 +
|'''PB9'''
 +
|140
 +
|0.67
 +
|-
 +
|'''PB10'''
 +
|179
 +
|1.25
 +
|}
 +
<center>Table 2: Fitted parameters obtained from least-squared curve fitting of six selected constructs.</center>
 +
 
 +
 
 +
===Discussion and outlook===
 +
Result from the 2LF-screen shows that PB1, PB2, PB3 and PB8 constructs (corresponding to promoter AP1, AP2, AP3 and AP8) showcased higher maximal expression but maintained same level of leakiness as that of PB10 (wild-type pBAD). <b>AP2 and AP3 are definite contenders for significant improvements, being only half the length of their wild-type counterpart</b>. We do not consider here AP8 as an improvement in our project, as this single rationale was fully accredited by the 2013 DTU Team. Still, it is worthwhile to note that in their previous characterization, the SPL (-35)-to-(-10) segment was incorporated into the wildtype length. Here, we put the optimised segment into the truncated 130 bp length, which also showed predictably high fold-change.
 +
We had slight issues with the induction assay. The experimental design failed to take into account the arabinose concentration range between 0 and 10uM. Therefore, for PB5, PB6, and PB7, we could not investigate the kinetics within this range. Our preliminary fitted curves for these functions (not shown) indicated a very steep, ‘all-or-nothing’ behaviour, and their maximal expression starts to plateau from even as low as 10uM. We hypothesised such observations with two possibilities:
 +
*These promoters were ‘accidentally’ engineered to have a very sharp dynamic range (ie. Hill’s coefficient is very large) and thus confer a “switch-like” mechanism of action. In other words, only a minimal concentration of arabinose is enough to fully activate the promoter. (Note that this was not our original aim of improvement).
 +
*These promoters still have predicted Hill’s kinetics, but the sigmoidal range (between 0 and 10uM) was not investigated thoroughly. This would mean that their dissociation constants are much smaller than that of the wild-type, shifting the functions left.
 +
More careful testing must be done to verify these scenarios.
 +
 
 +
It was, perhaps not very surprising, that AP4 (containing all three optimizations) did not live up to the expectation. We hypothesised that the modification in araI sites interfered with the SPL segment, which severely reduces the maximal strength. We also observed the same phenomenon between AP6 (- + +) and AP8 (- - +). From the time-dependent FI curve, we observed that cells with PB4 construct (containing AP4) consistently showed a strong fluorescence burst, followed by a quick drop. Furthermore, beyond 10uM, PB4 shared similar behaviour with the three promoters above in that FI is relatively unchanged (possibly reaching maximum already). Glancing at OD600 graphs, we noted that PB4 cell viability is comparable to the rest, with no sign of impeded growth. We hypothesised that the FI drop could be due to an intrinsic mechanism that degrades mVenus protein, or somehow purposely interferes with the transcription mechanism. It might also be possible that the overengineered mechanism causes a ‘’congestion’’ of araC onto the araI1-araO2 site, which permanently blocks transcription. Though PB4 is unable to serve as an improved part, future investigations could generate very interesting knowledge about the underlying emergent mechanism of this P_BAD.
 +
 
 +
Moreover, AP5, which is similar to AP4 but instead with a 78 bp spacing, showed some promise for its towering maximal strength, but is unfortunately devalued by the higher leakiness compared to wild-type.  It is interesting to note that AP5 did not suffer the burst-effect like AP4 did; therefore, it can be reasonably assumed that the spacing of 56 bp did have a drastic influence on AP4’s performance.
 +
 
 +
We are optimistic that AP9, despite lacking all three optimizations and thus being the most truncated, can be of use in certain circumstances where an inducible promoter with low expression is favoured. We therefore also made the sequence available on the Registry.

Latest revision as of 09:49, 13 October 2022

pBAD_AP

pBAD_AP
Function Inducible promoter
Chassis Tested Escherichia coli (bacterial)
Assembly Used JUMP Assembly
Abstraction Hierarchy Part
Related Device BBa_K2442101
Backbone pSC101
Submitted by Cambridge iGEM 2022

This gene encodes an improved version of the wild-type araBAD promoter called pBAD_AP2, an inducible promoter controlled by araC protein. The native pBAD is part of the araBAD operon, which is responsible for regulating arabinose metabolism in E.coli. pBAD_AP2 belongs to a collection of newly-designed araBAD promoters that are below 160 bp! As the Registry does not generally allow an entry with multiple sequences, we gave the sequence of pBAD_AP2 only as a representative (shows significant improvement), but all remaining sequences are also given below for completeness .

Usage and Biology

The exact definition of the araBAD promoter varies ambiguously between sources. Historically, pBAD only refers to a short segment upstream of the +1 transcription start site (referred to as the core promoter), containing the -35 and -10 boxes. However, as a complete promoter Part, the regulatory region further upstream is also included. In the following discussion, our definition of pBAD refers to the whole sequence consisting of both the regulatory sequence and the core promoter.

Figure 1: Schematic diagram of the araBAD operon and its upstream regulatory region.

The araBAD promoter regulates the araBAD operon and is controlled by araC - a regulatory protein known for its “love-hate” mechanism of action. The upstream regulatory region consists of various protein binding sites - araI1, araI2, araO1 and araO2 can be occupied by araC. Between araI1 and araO1 also lies a CAP binding site, which recruits Catabolite receptor protein for transcription activation. The spacing between araO1 and O2 is noticeably large, reaching nearly 210 bp, which, unsurprisingly, is responsible for the overall bulkiness of the promoter. Interestingly, a region within this spacer contains a promoter of araC gene, which runs in the opposite direction to the araBAD operon. This promoter is regulated by araO1 just downstream. The araC protein therefore not only regulates the araBAD operon but also controls its own production by binding to araO1 region (negative autoregulation).

In the absence of L-arabinose, transcription is repressed by the action of two araC molecules binding to the structure. One araC binds to araI1 and the other binds to araO2 further upstream. The dimerization domain confers high affinity, bringing the two protein molecules closer to dimerize, essentially creating a DNA loop as a result. This looping mechanism prevents any sigma factors, RNA Polymerase or CRP from being recruited, thus repressing transcription.

In the presence of L-arabinose, binding of the sugar molecule to the arabinose-binding domain triggers a conformational change in the DNA-binding domain of araC, which reduces its affinity to distal araO2 site. This makes the protein more favourable to bind to araI2, just downstream of araI1. Therefore, the dimerized complex is formed at araI1-araI2 site instead of araO2-araI1, which breaks the loop and hence activates transcription. The dimer araC also “nudges” the RNA Polymerase for enhanced transcription.

Figure 2: Schematic diagram of the regulatory mechanism of araBAD operon in the absence (top) or presence (bottom) of arabinose.

pBAD Entries in the Registry

Our team essentially created a family of combinatorial pBADs, some of which yielded significant improvement from the wild-type version. We list below several previous entries of the araBAD promoters, some of which may offer stronger merits in certain aspects. All of our designs have a truncated length of less than 160 base pairs, which is only half of the typical size.

Preamble from the Cambridge team

The Cambridge 2022 Team had intended to use the araBAD promoter to build an antithetic feedback circuit that demonstrates robust perfect adaptation (RPA). However, we were concerned that wild-type PBAD is relatively large, topping at around 300 bp, which increases the bulkiness of our Level-2 construct and reduces efficiency. Also, pBAD, by nature, is a relatively leaky and medium-strength promoter, therefore, lots of araC is needed to fully reach maximal activation. However, overexpression of araC is toxic to cells, and thus can drastically impede performance of the circuit. we therefore thought it would be an interesting Part Improvement project to redesign the existing wild-type promoter. Our initial goal was to engineer a PBAD with minimal length, but shows both lower leakiness and higher maximal activity. To achieve this, we did intensive literature search for prior optimization strategies. To understand the rationales, we also gathered information on the regulatory mechanism of the promoter, which was presumably only prevalent in papers from the 1970s.

We envisioned that the significant reduction in the promoter’s size can be of frugal advantage for future circuit designs. With less than 150 bp, the promoter can be synthesised by oligo-annealing, which is significantly faster and cheaper than ordering DNA parts. This could also be of great benefit for future iGEM teams from regions where DNA synthesis and delivery are often slow, allowing them to speed up project timelines.

pBAD_AP sequences

The table below shows nine newly-designed araBAD promoters, all with less than 160 base pairs. To see our design rationales for all sequences, please check out the Design page.

Identifiera Rationale 1b Rationale 2 Rationale 3 Part sequences
AP1 + - - agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta

cctgacgctttttatcgcaactctctactgtttctccatacccg

AP2 + + - agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat

cctgacgctttttatcgcaactctctactgtttctccatacccg

AP3 + - + agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggat

cctacctgacgctttttatcgcaactctctactgtttctccatacccg

AP4 + + + agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat

cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg

AP5 + + (78)c + agaaaccaattgtccatattgcatcagacattgccgtcacattgattatttgcacggcgtcacactttgctatgccatagcaagatagt

ccataagattagcgtttttatcctgacgtgcgcctgccgtccaaagtaatatccttacatacccg

AP6 - + - acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat

cctgacgctttttatcgcaactctctactgtttctccatacccg

AP7 - + + acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat

cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg

AP8 - - + acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta

cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg

AP9 - - - agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta

cctgacgctttttatcgcaactctctactgtttctccatacccg

a AP refers to the initials of the principal designer of the araBAD promoters.

b(-) in Rationale 1 refers to complete removal of both araO2 and the spacing, but still leaves the CAP binding site.

c AP5 has a spacing of 78 bp instead of the common 56 bp.

Experimental design

To test the designed araBAD promoters, we cloned nine respective Level 0 promoter parts into Level 1 JUMP constructs, using a standard Golden Gate Assembly protocol with BsaI-HFv2. Lying downstream of the promoter is a B0032 medium RBS, an mVenus reporter and a DT5 double terminator. A medium-strength RBS was chosen to avoid burden caused by accidental overexpression of mVenus. All TUs were put into a pJUMP27-1A destination vector. The low copy number plasmid makes it favourable for avoiding phototoxicity and aggregate bodies, as well as reducing noise. A list of constructs ID and their respective constituent promoter is given below.


Figure 3: Schematic representation (in SBOL) of Level 1 PB constructs.
LVL1 ID Promoter
PB1 AP1
PB2 AP2
PB3 AP3
PB4 AP4
PB5 AP5
PB6 AP6
PB7 AP7
PB8 AP8
PB9 AP9
PB10 BBa_K2442101
PBneg dummy control

Golden-gate-assembled mixtures were chemically transformed into DH5alpha cells for selection on Kanamycin plates. cPCR was carried out on seemingly-good colonies to screen for bands with correct size. Colonies with successful assemblies, indicated by cPCR, were liquid cultured for next-day miniprep. The retrieved plasmids, once verified through Sanger sequencing, were then transformed into a Marionette-Wild strain by electroporation. We chose Marionette as the testing strain because it is highly optimised as an arabinose sensor. Colonies of Marionette cells (selected on Kanamycin plates) were inoculated in 2 mL Neidhardt EZ Rich Defined Medium (EZRDM) and shaking-incubated overnight for 20 hours, at 37oC and 250 rpm.

Figure 4: Schematic representation of mechanism of action for LVL1 testing circuits in Marionette strain.


We conducted two experiments to validate the nine pBADs against the wild-type counterpart and a negative control. The negative control (termed PBneg) was a dummy construct with similar length, containing mVenus CDS, but no araBAD promoters. Both the wild-type (PB10) and the PBneg constructs were cloned using the method described above.

Both experiments would involve measuring mVenus fluorescence intensity (FI) of transformed Marionettes grown under varying arabinose concentrations. FI was measured using a ClarioStar plate reader, on Greiner F-bottom 96-well plates or standard Greiner 384-well plates.

Results

Two-Level factorial screen

We first investigated the leakiness and maximal strength of the eight P_BADs. We chose arabinose concentrations of 0 uM and 1000 uM as the testing conditions. We shall, for now, not take Hill’s dynamics into account, and focus solely on the two concentration endpoints that best showcase the promoters’ two characteristics. We also calculated the fold-change (or fold-induction), defined as the ratio of maximal expression to leakiness:

Fold change = Max expression / Leakiness

Each sample was done in four replicates. The raw data are plotted in Figure 5,6 and 7.

Figure 5: Time-dependent FI measurement of all PB constructs at 0uM and 1000uM arabinose concentrations.


Figure 6: Time-dependent OD600 measurement showing cell growth of transformed Marionettes at 0uM and 1000uM arabinose concentrations.


Figure 7: Performances (leakiness, maximal expression and fold-change) of Marionettes with different PB constructs, measured by fluorescence intensity (a.u.). The scale of the circles indicates the degree of fold-change. x-axis is leakiness, y-axis is max. expression.

Hill's induction assay

We also hoped to characterise classical parameters of inducible systems, namely, the dissociation constant KD and the Hill’s coefficient n. Therefore, we carried out a combinatorial induction assay with arabinose concentrations ranging from 0, 10, 25, 50, 75, 100, 125, 200, 500, 1000 and 2000 uM. For this testing, we used a 384-well plate instead to test all constructs; and a robot called Opentron OT-2 to automate plate preparation. Results are shown below.

Figure 8: Time-dependent FI measurement showing cell growth of transformed Marionettes under varying arabinose concentrations.
Figure 9: Time-dependent OD600 measurement showing cell growth of transformed Marionettes under varying arabinose concentrations.

We selected PB1, PB2, PB3, PB8, PB9 and PB10 and used the template equation given in Meyer et al (2019) for least-square regression. An example plot for the fitted curve of PB10 is given in Figure 10, and the six fitted functions are collected in a single plot in Figure 11.

Figure 10: Fitted Hill’s function of PB10 (containing wild-type P_BAD) under varying arabinose concentrations.
Figure 11: Fitted Hill’s functions of selected PB constructs (PB1, PB2, PB3, PB8, PB9 and PB10) under varying arabinose concentrations.
LVL1 ID KD (uM) (fitted) Hill's coefficient n (fitted)
PB1 29.6 0.54
PB2 31.1 0.56
PB3 32.9 0.54
PB8 64.5 0.63
PB9 140 0.67
PB10 179 1.25
Table 2: Fitted parameters obtained from least-squared curve fitting of six selected constructs.


Discussion and outlook

Result from the 2LF-screen shows that PB1, PB2, PB3 and PB8 constructs (corresponding to promoter AP1, AP2, AP3 and AP8) showcased higher maximal expression but maintained same level of leakiness as that of PB10 (wild-type pBAD). AP2 and AP3 are definite contenders for significant improvements, being only half the length of their wild-type counterpart. We do not consider here AP8 as an improvement in our project, as this single rationale was fully accredited by the 2013 DTU Team. Still, it is worthwhile to note that in their previous characterization, the SPL (-35)-to-(-10) segment was incorporated into the wildtype length. Here, we put the optimised segment into the truncated 130 bp length, which also showed predictably high fold-change. We had slight issues with the induction assay. The experimental design failed to take into account the arabinose concentration range between 0 and 10uM. Therefore, for PB5, PB6, and PB7, we could not investigate the kinetics within this range. Our preliminary fitted curves for these functions (not shown) indicated a very steep, ‘all-or-nothing’ behaviour, and their maximal expression starts to plateau from even as low as 10uM. We hypothesised such observations with two possibilities:

  • These promoters were ‘accidentally’ engineered to have a very sharp dynamic range (ie. Hill’s coefficient is very large) and thus confer a “switch-like” mechanism of action. In other words, only a minimal concentration of arabinose is enough to fully activate the promoter. (Note that this was not our original aim of improvement).
  • These promoters still have predicted Hill’s kinetics, but the sigmoidal range (between 0 and 10uM) was not investigated thoroughly. This would mean that their dissociation constants are much smaller than that of the wild-type, shifting the functions left.

More careful testing must be done to verify these scenarios.

It was, perhaps not very surprising, that AP4 (containing all three optimizations) did not live up to the expectation. We hypothesised that the modification in araI sites interfered with the SPL segment, which severely reduces the maximal strength. We also observed the same phenomenon between AP6 (- + +) and AP8 (- - +). From the time-dependent FI curve, we observed that cells with PB4 construct (containing AP4) consistently showed a strong fluorescence burst, followed by a quick drop. Furthermore, beyond 10uM, PB4 shared similar behaviour with the three promoters above in that FI is relatively unchanged (possibly reaching maximum already). Glancing at OD600 graphs, we noted that PB4 cell viability is comparable to the rest, with no sign of impeded growth. We hypothesised that the FI drop could be due to an intrinsic mechanism that degrades mVenus protein, or somehow purposely interferes with the transcription mechanism. It might also be possible that the overengineered mechanism causes a ‘’congestion’’ of araC onto the araI1-araO2 site, which permanently blocks transcription. Though PB4 is unable to serve as an improved part, future investigations could generate very interesting knowledge about the underlying emergent mechanism of this P_BAD.

Moreover, AP5, which is similar to AP4 but instead with a 78 bp spacing, showed some promise for its towering maximal strength, but is unfortunately devalued by the higher leakiness compared to wild-type. It is interesting to note that AP5 did not suffer the burst-effect like AP4 did; therefore, it can be reasonably assumed that the spacing of 56 bp did have a drastic influence on AP4’s performance.

We are optimistic that AP9, despite lacking all three optimizations and thus being the most truncated, can be of use in certain circumstances where an inducible promoter with low expression is favoured. We therefore also made the sequence available on the Registry.