Difference between revisions of "Part:BBa K4260008"

 
(2 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<strong><font size=5>Tryptophan, rho-independent terminator</font></strong></br>
 
<strong><font size=5>Tryptophan, rho-independent terminator</font></strong></br>
 
<br><font size=3><strong>Type:</strong> Terminator</font></br>
 
<br><font size=3><strong>Type:</strong> Terminator</font></br>
<br><font size=3 color=red><strong>Designed by: </strong> -----</font></br>
 
 
<br><font size=3><strong>Group:</strong> iGEM_TecCEM</font></br>
 
<br><font size=3><strong>Group:</strong> iGEM_TecCEM</font></br>
 
<br>
 
<br>
<p align = "justify">This part is a 20 bp-long terminator, from the Trp operon, that forms a stem-loop structure. The tryptophan operator provides transcription efficiency as a terminator design, promoting a rho-independent or intrinsic termination. This means that the termination process carried out by Trp terminator does not depend on the presence of termination factors [1]. Moreover, it shares several features with other known sites of transcription termination of E. Coli.  The tryptophan terminator was designed with scientific literature and iGEM team's research, in this way it was used for the transcription termination of a gene of another part (to know more, please visit <a href="https://parts.igem.org/Part:BBa_K729002">BBa_K4260006</a>), that was tested in E.coli DH5α and BL21 strains with experimental procedures.  
+
<p align = "justify">This part is a 20 bp-long terminator, from the Trp operon, that forms a stem-loop structure. The tryptophan operator provides transcription efficiency as a terminator design, promoting a rho-independent or intrinsic termination. This means that the termination process carried out by Trp terminator does not depend on the presence of termination factors [1]. Moreover, it shares several features with other known sites of transcription termination of E. Coli.  The tryptophan terminator was designed with scientific literature and iGEM team's research, in this way it was used for the transcription termination of a gene of another part (to know more, please visit <a href="https://parts.igem.org/Part:BBa_K4260006">BBa_K4260006</a>), that was tested in E.coli DH5α and BL21 strains with experimental procedures.  
 
</p>
 
</p>
 
<br><font size=3><strong><em>Sequence & Features</em></font></strong></br>
 
<br><font size=3><strong><em>Sequence & Features</em></font></strong></br>
Line 29: Line 28:
 
</tr>
 
</tr>
 
<tr>
 
<tr>
<td><center><strong>Fig. 2</strong>Structure prediction of the <br> Tpr terminator. [Obtained with UNAFold].</center></td>
+
<td><center><strong>Fig. 2</strong> Structure prediction of the <br> Tpr terminator. [Obtained with UNAFold].</center></td>
 
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
 
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
 
<td><center><strong>Fig. 3</strong> Additional thermodynamic information of <br>the structure prediction. [Obtained with UNAFold]</center></td>
 
<td><center><strong>Fig. 3</strong> Additional thermodynamic information of <br>the structure prediction. [Obtained with UNAFold]</center></td>
Line 39: Line 38:
 
<br>
 
<br>
 
<p align = "justify">[1] Chen, J., Morita, T. & Gottesman, S. (2019). <em>Regulation of Trsncription Termination of Small RNAs and by Smll RNAs: Molecular Mechanisims and Biological Functions. </em> Frontiers in Cellular and Infection Microbiology. <a href="https://doi.org/10.3389/fcimb.2019.00201">https://doi.org/10.3389/fcimb.2019.00201</a></p></br>
 
<p align = "justify">[1] Chen, J., Morita, T. & Gottesman, S. (2019). <em>Regulation of Trsncription Termination of Small RNAs and by Smll RNAs: Molecular Mechanisims and Biological Functions. </em> Frontiers in Cellular and Infection Microbiology. <a href="https://doi.org/10.3389/fcimb.2019.00201">https://doi.org/10.3389/fcimb.2019.00201</a></p></br>
<hr>
+
 
<br>
+
<p align = "justify">Tested to recognize its functionality in  Thus experimental measuring was performed on the Safety project proposal by Tec CEM 2022 and it was found not to be difficult to use and has an automatic adjustment to experimental protocols.
+
</p></br>
+
 
</html>
 
</html>

Latest revision as of 01:19, 10 October 2022


Tryptophan, rho-independent terminator

Type: Terminator

Group: iGEM_TecCEM

This part is a 20 bp-long terminator, from the Trp operon, that forms a stem-loop structure. The tryptophan operator provides transcription efficiency as a terminator design, promoting a rho-independent or intrinsic termination. This means that the termination process carried out by Trp terminator does not depend on the presence of termination factors [1]. Moreover, it shares several features with other known sites of transcription termination of E. Coli. The tryptophan terminator was designed with scientific literature and iGEM team's research, in this way it was used for the transcription termination of a gene of another part (to know more, please visit BBa_K4260006), that was tested in E.coli DH5α and BL21 strains with experimental procedures.


Sequence & Features


Fig. 1 Sequence scheme.

Length: 20 bp

Direction: Reverse

Sequence (5’ to 3’): CCCACTCAGTAGTGGGTTTT

The secondary structure prediction was obtained with UNAFold, indicating a ΔG value of -5.20. Other data obtained from the model is shown in the table below.


Fig. 2 Structure prediction of the
Tpr terminator. [Obtained with UNAFold].
Fig. 3 Additional thermodynamic information of
the structure prediction. [Obtained with UNAFold]

References

[1] Chen, J., Morita, T. & Gottesman, S. (2019). Regulation of Trsncription Termination of Small RNAs and by Smll RNAs: Molecular Mechanisims and Biological Functions. Frontiers in Cellular and Infection Microbiology. https://doi.org/10.3389/fcimb.2019.00201