Difference between revisions of "Part:BBa K4197020"

 
(3 intermediate revisions by one other user not shown)
Line 8: Line 8:
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
<p>The part expressing the gene of arachid Ara h 2 (<a href="https://parts.igem.org/Part:BBa_K4197008">K4197008</a>) has been completed with the ihfb800-mScarlet construction (<a href="https://parts.igem.org/Part:BBa_K4197022">K4197022</a>) to express red
+
<p>The mScarlet-I fluorescent reporter has been added on the plasmid allowing to express the gene of arachid Ara h 2 (<a href="https://parts.igem.org/Part:BBa_K4197008">K4197008</a>) on the surface of <i>E. coli</i>. Expression of mScarlet-I is driven by the ihfb800 promoter (see <a href="https://parts.igem.org/Part:BBa_K41970022">K41970022</a>).
fluorescence. This red fluorescence allows sorting of bacteria by FACS. </p>
+
This red fluorescence is destined to identify the allergen expressing cells by FACS.  
 +
</p>
 +
 
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
Line 15: Line 17:
 
IF4_mSCARLET-I R (atggtttctaaaggtgaagcagtg) primers. The expected size of the amplicon is 699 bp. The fragment was inserted on the linearized plasmid pET21b(+) with  
 
IF4_mSCARLET-I R (atggtttctaaaggtgaagcagtg) primers. The expected size of the amplicon is 699 bp. The fragment was inserted on the linearized plasmid pET21b(+) with  
 
Ara h 2 (<a href="https://parts.igem.org/Part:BBa_K4197008">K4197008</a>) by In-Fusion.  </p>
 
Ara h 2 (<a href="https://parts.igem.org/Part:BBa_K4197008">K4197008</a>) by In-Fusion.  </p>
<p>The resulting products were transformed into Stellar cells and positive transformants were selected.</p>
+
<p>The resulting products were transformed into Stellar cells and positive transformants were selected. The correct sequence was further assessed by sequencing.</p>
  
 
      
 
      
Line 21: Line 23:
 
 
 
<h2>Validation</h2>
 
<h2>Validation</h2>
<p>Successful colonies have shown bright pink fluorescence (Figure 1).</p>
+
<p>Successful colonies have shown pink coloring even without excitation light indicating the expression of the mScarlet-I, thus validating the mScarlet-I addition to the construction and its correct expression driven by the <i>ihfB</i> promoter (Figure 1).</p>
 
<div class="center">
 
<div class="center">
 
     <div class="thumb tnone">
 
     <div class="thumb tnone">
Line 30: Line 32:
 
                     <a href="https://static.igem.wiki/teams/4197/wiki/results/facs/fig-56-mscarlet-petri.jpg" class="internal" title="Enlarge"></a>
 
                     <a href="https://static.igem.wiki/teams/4197/wiki/results/facs/fig-56-mscarlet-petri.jpg" class="internal" title="Enlarge"></a>
 
                 </div>
 
                 </div>
                 <b>Figure 2: </b><b>Second plating of pET-21 b (+)_Ara h 2_OmpA_mScarlet-I transformed cells and pET-21 b (+)_Ana o 3_OmpA_mScarlet-I transformed Stellar cells. </b>   
+
                 <b>Figure 1: </b><b>Second plating of pET-21 b (+)_Ara h 2_OmpA_mScarlet-I transformed cells and pET-21 b (+)_Ana o 3_OmpA_mScarlet-I transformed Stellar cells. </b>   
                 The colonies were selected on LB-ampicillin plates. Pink coloring indicates the expression of the mScarlet-I.
+
                 The colonies were selected on LB-ampicillin plates.  
 
             </div>
 
             </div>
 
         </div>
 
         </div>
Line 38: Line 40:
  
 
      
 
      
<h2>References</h2>
+
<h2>DAISY PROJECT</h2>
 
<ol>
 
<ol>
<li> <a href="https://parts.igem.org/Part:BBa_K4197008">K4197008</a> </li>
 
<li> <a href="https://parts.igem.org/Part:BBa_K4197022">K4197022</a> </li>
 
 
<li> <a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </li>
 
<li> <a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </li>
 
</ol>
 
</ol>
Line 53: Line 53:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K4197003 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4197020 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
<partinfo>BBa_K4197003 parameters</partinfo>
+
<partinfo>BBa_K4197020 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 18:45, 10 October 2022


Ara h 2 expression at the surface of E. coli cells sortable by FACS using mSCARLET-I

OmpA_Ara h 2 fusion + mSCARLET-I with ihfb800 promoter

Introduction

The mScarlet-I fluorescent reporter has been added on the plasmid allowing to express the gene of arachid Ara h 2 (K4197008) on the surface of E. coli. Expression of mScarlet-I is driven by the ihfb800 promoter (see K41970022). This red fluorescence is destined to identify the allergen expressing cells by FACS.

Construction

The ihfb800-mScarlet construction was amplified by PCR with the high-fidelity Phusion polymerase using IF3_mSCARLET-I F (ttatttgtacagttcatccataccacc) and IF4_mSCARLET-I R (atggtttctaaaggtgaagcagtg) primers. The expected size of the amplicon is 699 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ara h 2 (K4197008) by In-Fusion.

The resulting products were transformed into Stellar cells and positive transformants were selected. The correct sequence was further assessed by sequencing.

Validation

Successful colonies have shown pink coloring even without excitation light indicating the expression of the mScarlet-I, thus validating the mScarlet-I addition to the construction and its correct expression driven by the ihfB promoter (Figure 1).

Figure 1: Second plating of pET-21 b (+)_Ara h 2_OmpA_mScarlet-I transformed cells and pET-21 b (+)_Ana o 3_OmpA_mScarlet-I transformed Stellar cells. The colonies were selected on LB-ampicillin plates.

DAISY PROJECT

  1. DAISY (INSA-UPS 2022)

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1520
    Illegal EcoRI site found at 1734
    Illegal XbaI site found at 1505
    Illegal XbaI site found at 1651
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1520
    Illegal EcoRI site found at 1734
    Illegal NheI site found at 1696
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1512
    Illegal NotI site found at 2792
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1520
    Illegal EcoRI site found at 1734
    Illegal BglII site found at 1585
    Illegal BamHI site found at 1728
    Illegal BamHI site found at 2417
    Illegal BamHI site found at 2438
    Illegal XhoI site found at 2801
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1520
    Illegal EcoRI site found at 1734
    Illegal XbaI site found at 1505
    Illegal XbaI site found at 1651
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1520
    Illegal EcoRI site found at 1734
    Illegal XbaI site found at 1505
    Illegal XbaI site found at 1651
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1475
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 2317