Difference between revisions of "Part:BBa K4197004"

 
(2 intermediate revisions by one other user not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197004 short</partinfo>
 
<partinfo>BBa_K4197004 short</partinfo>
Brick expressing Ara h 2 at the surface of <i>E. coli</i> cell sortable by FACS
+
 
 
<html>
 
<html>
  
Line 73: Line 73:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K4197003 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4197004 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
<partinfo>BBa_K4197003 parameters</partinfo>
+
<partinfo>BBa_K4197004 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 18:36, 10 October 2022


Ara h 2 expression at the surface of E. coli cells sortable by FACS using mRFP1

Introduction

The mRFP1 fluorescent reporter has been added on the plasmid allowing to express the gene of arachid Ara h 2 (K4197008) on the surface of E. coli. Expression of mRFP1 is driven by the ihfb800 promoter (see K41970012). This red fluorescence is destined to identify the allergen expressing cells by FACS.

Construction

The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ara h 2 (K4197008) by In-Fusion.

The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R (ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 3046 bp with RFP and 1454 bp without.

Figure 1: Verification of the insertion of RFP fragment in Ara h 2 with gel. The PCR screening was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colonies 1, 2 and 3 have shown the right size.

Successful colonies were further tested by digestion with NotI which cut both in the plasmid and in the mRFP1 gene (Figure 2). Correct sizes were expected to be 1280 and 6791 bp for Ara h 2.

Figure 2: Digestion by NotI of Ara h 2 with mRFP1 insertion. The digestion product was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colonies 21 and 23 present the correct size for Ara h 2.

Validation

This construction has not shown red fluorescence on the microscope. After sequencing, a mutation has been revealed on the mRFP1 sequence which does not allow us to continue further with this construction.

DAISY Project

  1. DAISY (INSA-UPS 2022)


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal NheI site found at 1703
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1519
    Illegal NotI site found at 2799
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal BglII site found at 1592
    Illegal BamHI site found at 1735
    Illegal BamHI site found at 2424
    Illegal BamHI site found at 2445
    Illegal XhoI site found at 2808
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1360
    Illegal AgeI site found at 1472
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 2324