Difference between revisions of "Part:BBa K4221002"
(→Detection of fusion protein function) |
|||
(11 intermediate revisions by 2 users not shown) | |||
Line 15: | Line 15: | ||
===Usage=== | ===Usage=== | ||
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. | Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. | ||
+ | |||
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. | Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. | ||
− | Using EBFP[2] as target | + | Using EBFP[2] as target protein can visually observe fluorescent protein (EBFP,target protein) showing blue fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect. |
===Biology=== | ===Biology=== | ||
Blue fluorescent protein (BFP)[3] was mutant of GFP which originally identified from the jellyfish (Aequorea victoria). | Blue fluorescent protein (BFP)[3] was mutant of GFP which originally identified from the jellyfish (Aequorea victoria). | ||
− | Design Consideration | + | |
− | The construct was cloned into a | + | ===Design Consideration=== |
+ | The construct was cloned into a pET28a plasmid and transformed into BL21 (DE3) E. coli and Rosetta E. coli. | ||
+ | |||
The construction includes: | The construction includes: | ||
+ | |||
EBFP is fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT) | EBFP is fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT) | ||
and TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT) | and TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT) | ||
+ | |||
+ | ===Protein Expression=== | ||
+ | |||
+ | We transformed recombinant plasmids (pET28a-EBFP-GSlinker-BslA) into BL21 and Rosetta expressing strains. | ||
+ | |||
+ | [[File:figure-2 a .png|500px]]<br> | ||
+ | |||
+ | [[File:figure-2 b .png|500px]]<br> | ||
+ | |||
+ | '''Figure 1.'''(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG | ||
+ | (b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG, | ||
+ | |||
+ | [[File:figure-3 a .png|500px]]<br> | ||
+ | |||
+ | [[File:figure-3 b .png|500px]]<br> | ||
+ | |||
+ | '''Figure 2.'''(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG, | ||
+ | |||
===Detection of fusion protein function=== | ===Detection of fusion protein function=== | ||
+ | After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant (use 1×PBS as buffer). In order to verify that the fusion protein (EBFP-GSlinker-BslA) was successfully fused and expressed compared to the control group (EBFP). We attempted to conduct water contact angle experiments. Due to experimental conditions, we cannot use professional instruments. | ||
+ | We used parafilm as the substrate, which is an extremely hydrophobic interface, and added droplets of the supernatant of the control group and the supernatant of the fusion protein experimental group respectively for observation. We found that the contact angle of the control group was much smaller than that of the experimental group. This means that the supernatant of the control group was hydrophobic as a whole, while the experimental group was hydrophilic. BslA, as a hydrophobin, has the characteristic of reversing surface properties. Through this experiment, we can prove the existence of BslA in the experimental group. | ||
− | Figure | + | [[File:figure-8 b .png|500px]]<br> |
+ | '''Figure 3.'''Water contact angle. | ||
+ | |||
+ | ===Aqueous two-phase separation (ATPS) Testing=== | ||
+ | Then, we used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated. We found that the fluorescence color was still in the lower layer (aqueous phase) in both the experimental group and the control group. | ||
+ | |||
+ | In theory, fluorescence should appear in the upper layer (organic phase) because When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. | ||
+ | |||
+ | Our experiments did not get perfect results, we analyzed some possible reasons and tried to continue experiments to explore in the future. | ||
+ | |||
+ | First, the current system is still small. Although we can see the fluorescence color, it is very shallow, and even though there may be some fluorescence in the organic phase, it is not visible to the naked eye due to the small amount. Therefore, we need to expand the system of protein-induced expression in the future. | ||
+ | |||
+ | Second, this may be related to the choice of buffer. We used 1xPBS to dissolve the supernatant obtained after sonication, and it may be possible to change the buffer of other pH to have different results. | ||
+ | |||
+ | Third, it may be related to the hydrophilicity and hydrophobicity of the supernatant. The supernatant contains all proteins expressed by the cells, including the target protein. Through the water contact angle experiment, we can find that the supernatant of the control group is hydrophobic as a whole, which may be caused by the hydrophobicity of some endogenous proteins in cells. Their presence may affect the function of BslA in the ATPS system. | ||
+ | |||
+ | |||
+ | Based on a review published at 2016 (Iqbal,M. et al.), we assumed that other potential rationales that contribute unsuccessful partitioning of protein in ATPS might be unsuitable concentration of salt aqueous solution, unsuitable temperature and incorrect selection of solute in organic phase. Extremely high concentration of salts may alter the hydrophobicity of biomolecules. As a consequence of the hydrophobic ions force the partitioning of counter ions to phase with higher hydrophobicity and vice versa. Thereafter, the addition of salts has critical influence on the partitioning coefficient based on following equation. The temperature can alter the coefficient as well. Moreover, it can generate effect on partitioning through the through viscosity and density. | ||
+ | |||
+ | [[File:figure-9 a .png|500px]]<br> | ||
+ | '''Figure 4.''' ATPS testing. | ||
===Reference=== | ===Reference=== | ||
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30) | [1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30) | ||
+ | |||
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73. | [2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73. | ||
+ | |||
[3]PapadakiStavrini; Xinyue Wang; Yangdong Wang. Etc. Dual-expression system for blue fluorescent protein optimization.[J]. Scientific reports, 2022(3). | [3]PapadakiStavrini; Xinyue Wang; Yangdong Wang. Etc. Dual-expression system for blue fluorescent protein optimization.[J]. Scientific reports, 2022(3). | ||
Latest revision as of 07:51, 11 October 2022
EBFP
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Usage
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using EBFP[2] as target protein can visually observe fluorescent protein (EBFP,target protein) showing blue fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
Biology
Blue fluorescent protein (BFP)[3] was mutant of GFP which originally identified from the jellyfish (Aequorea victoria).
Design Consideration
The construct was cloned into a pET28a plasmid and transformed into BL21 (DE3) E. coli and Rosetta E. coli.
The construction includes:
EBFP is fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT) and TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT)
Protein Expression
We transformed recombinant plasmids (pET28a-EBFP-GSlinker-BslA) into BL21 and Rosetta expressing strains.
Figure 1.(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG (b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
Figure 2.(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
Detection of fusion protein function
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant (use 1×PBS as buffer). In order to verify that the fusion protein (EBFP-GSlinker-BslA) was successfully fused and expressed compared to the control group (EBFP). We attempted to conduct water contact angle experiments. Due to experimental conditions, we cannot use professional instruments. We used parafilm as the substrate, which is an extremely hydrophobic interface, and added droplets of the supernatant of the control group and the supernatant of the fusion protein experimental group respectively for observation. We found that the contact angle of the control group was much smaller than that of the experimental group. This means that the supernatant of the control group was hydrophobic as a whole, while the experimental group was hydrophilic. BslA, as a hydrophobin, has the characteristic of reversing surface properties. Through this experiment, we can prove the existence of BslA in the experimental group.
Aqueous two-phase separation (ATPS) Testing
Then, we used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated. We found that the fluorescence color was still in the lower layer (aqueous phase) in both the experimental group and the control group.
In theory, fluorescence should appear in the upper layer (organic phase) because When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
Our experiments did not get perfect results, we analyzed some possible reasons and tried to continue experiments to explore in the future.
First, the current system is still small. Although we can see the fluorescence color, it is very shallow, and even though there may be some fluorescence in the organic phase, it is not visible to the naked eye due to the small amount. Therefore, we need to expand the system of protein-induced expression in the future.
Second, this may be related to the choice of buffer. We used 1xPBS to dissolve the supernatant obtained after sonication, and it may be possible to change the buffer of other pH to have different results.
Third, it may be related to the hydrophilicity and hydrophobicity of the supernatant. The supernatant contains all proteins expressed by the cells, including the target protein. Through the water contact angle experiment, we can find that the supernatant of the control group is hydrophobic as a whole, which may be caused by the hydrophobicity of some endogenous proteins in cells. Their presence may affect the function of BslA in the ATPS system.
Based on a review published at 2016 (Iqbal,M. et al.), we assumed that other potential rationales that contribute unsuccessful partitioning of protein in ATPS might be unsuitable concentration of salt aqueous solution, unsuitable temperature and incorrect selection of solute in organic phase. Extremely high concentration of salts may alter the hydrophobicity of biomolecules. As a consequence of the hydrophobic ions force the partitioning of counter ions to phase with higher hydrophobicity and vice versa. Thereafter, the addition of salts has critical influence on the partitioning coefficient based on following equation. The temperature can alter the coefficient as well. Moreover, it can generate effect on partitioning through the through viscosity and density.
Reference
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
[3]PapadakiStavrini; Xinyue Wang; Yangdong Wang. Etc. Dual-expression system for blue fluorescent protein optimization.[J]. Scientific reports, 2022(3).