Difference between revisions of "Part:BBa K4197018"

 
(4 intermediate revisions by one other user not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197018 short</partinfo>
 
<partinfo>BBa_K4197018 short</partinfo>
  
Gene coding for the egg allergen called Gal d 2.
+
Gene coding for the egg allergen Gal d 2  
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
<p>This part is composed of the gene coding for the allergen of Hen’s egg Gal d 2 (NCBI: <a "https://www.ncbi.nlm.nih.gov/nuccore/V00383.1/">V00383.1</a>). The Hen's egg allergy prevalence is 0,5-2,5% in developped countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in <i>Express Iq E. coli </i>and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015). Gal d 2 was merged to the membrane protein OmpA of <i>E. coli </i> from part <a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>. This lippoprotein is the most abundant in <i>E. coli's </i>membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (yang and al. 2016). </p>
+
<p>This part is composed of the gene coding for the allergen of hen’s egg Gal d 2 (NCBI: <a "https://www.ncbi.nlm.nih.gov/nuccore/V00383.1/">V00383.1</a>). The hen's egg allergy prevalence is 0,5-2,5% in developed countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015).</p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
<p>OmpA_Gal d 2 fragment from IDT gblock was amplified by PCR using the high fidelity Phusion polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg) and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. Expected size of the amplicon was 1675 bp.</p>
+
<p>The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lipoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197009">BBa_K1694009</a>).</p>
  
<p>pET-21 b (+) vector was linearized by PCR using the high fidelity Phusion polymerase with  primers FORWARD:tgtcgacggagctcgaattcg and REVERSE:ttaaagcttgcggccgcactcg. Expected size of the amplicon was 5442 bp.</p>
 
  
<p>Amplification product sizes were checked on EtBr stained agarose gel (Figure 1).</p>
+
<h2>References</h2>
 +
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
  
 +
<p>Other parts to display allergens:<br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197007"> OmpA_Ana o 3</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Der p 1</a> <br>
 +
</p>
  
<figure class="normal mx-auto">   
 
                                            <img
 
                                                                        class="d-block"
 
                                                                        src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/pet-21-b-linearized-and-gal-d-2-fragment.png" title= "Figure 1: pet lin and gal fragment" alt="Figure 2: pet lin and gal fragment"
 
                                                                        <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: pET-21 b (+) linearized (A) and Gal d 2 amplified fragment (B). Expected sizes of the amplicons were 5442 bp (A) and 1675 bp (B).</b> PCR amplicon sizes of pET-21 b (+) (A) and Gal d 2 (B) were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels. (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
 
                                        </figure>
 
 
<p>Amplification products matched the expected size, they were further purified from  gel.</p>
 
 
<p>The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were  transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone (FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc, expected size of the amplicon : 2092 bp). 2 positive transformants were detected (Figure 3).</p>
 
 
<figure class="normal mx-auto" style="width: 40vw;height: auto">   
 
                                            <img
 
                                                                        class="d-block"
 
                                                                        src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/gal-d-2-screening.png" title= "Figure 2: gal screening" alt="Figure 2: gal screening" class="img-fluid"
 
                                                                        <figcaption class="normal"><span class="titre-image"><i><b>Figure 2: identifying fragments that bear pET21 b (+)_Ompa_Gal d 2 by colony PCR. Expected size of the amplicon was 2092 bp. The positive clones were colonies 17 and 24.</b> PCR amplicon sizes of colonies with Gal d 2 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
 
                                        </figure>
 
 
<p>These transformants had their plasmid extracted by Miniprep and digested by EcoRV to assess the assembly (expected fragments at 4332 bp and 2785 bp, see Figure 4).</p>
 
 
<figure class="normal mx-auto" style="width: 40vw;height: auto">   
 
                                            <img
 
                                                                        class="d-block w-100"
 
                                                                        src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/gal-d-2-digestion.png" title= "Figure 3: gal digestion" alt="Figure 3: gal digestion" class="img-fluid"
 
                                                                        <figcaption class="normal"><span class="titre-image"><i><b>Figure 3: restriction profile of pET-21 b (+)_OmpA_Gal d 2 final construction. Enzyme used was EcoRV. Expected sizes of the amplicons were 4332 bp and 2785 bp.</b> Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
 
                                        </figure>
 
 
<p>The correct restriction maps were obtained and the insert sequence was further validated by sequencing. The plasmid was named <b>pET-21 b (+)_OmpA_Gal d 2</b>. The plasmids were eventually used to transform <i>E. coli</i> Tuner cells in order to express the OmpA_Gal d 2 construction at the cell membrane. But no proof was obtain of the expression. </p>
 
 
 
<h2>References</h2>
 
 
<ol>
 
<ol>
 
     <li>Dhanapala, P., Doran, T., Tang, M. L. K., & Suphioglu, C. (2015). Production and immunological analysis of IgE reactive recombinant egg white allergens expressed in Escherichia coli. Molecular Immunology, 65(1), 104–112. https://doi.org/10.1016/j.molimm.2015.01.006</li>
 
     <li>Dhanapala, P., Doran, T., Tang, M. L. K., & Suphioglu, C. (2015). Production and immunological analysis of IgE reactive recombinant egg white allergens expressed in Escherichia coli. Molecular Immunology, 65(1), 104–112. https://doi.org/10.1016/j.molimm.2015.01.006</li>
Line 54: Line 27:
 
     <li>Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954</li>
 
     <li>Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954</li>
  
<li>Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009</li>
 
 
<li>Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001</li>
 
 
</ol>
 
</ol>
 
</html>
 
</html>

Latest revision as of 08:27, 8 October 2022

Gene coding for Gal d 2

Gene coding for the egg allergen Gal d 2

Introduction

This part is composed of the gene coding for the allergen of hen’s egg Gal d 2 (NCBI: V00383.1). The hen's egg allergy prevalence is 0,5-2,5% in developed countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in E. coli and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015).

Construction

The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of E. coli so the ordered sequence was merged to OmpA membrane lipoprotein (see part BBa_K1694009).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Ana o 3
- OmpA_Der p 1

  1. Dhanapala, P., Doran, T., Tang, M. L. K., & Suphioglu, C. (2015). Production and immunological analysis of IgE reactive recombinant egg white allergens expressed in Escherichia coli. Molecular Immunology, 65(1), 104–112. https://doi.org/10.1016/j.molimm.2015.01.006
  2. Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 114
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 325