|
|
(22 intermediate revisions by one other user not shown) |
Line 1: |
Line 1: |
− |
| |
| __NOTOC__ | | __NOTOC__ |
| <partinfo>BBa_K4197018 short</partinfo> | | <partinfo>BBa_K4197018 short</partinfo> |
| | | |
− | Gene coding for the egg allergen called Gal d 2. | + | Gene coding for the egg allergen Gal d 2 |
| | | |
| <html> | | <html> |
| | | |
| <h2>Introduction</h2> | | <h2>Introduction</h2> |
− | <p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p> | + | <p>This part is composed of the gene coding for the allergen of hen’s egg Gal d 2 (NCBI: <a "https://www.ncbi.nlm.nih.gov/nuccore/V00383.1/">V00383.1</a>). The hen's egg allergy prevalence is 0,5-2,5% in developed countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015).</p> |
| | | |
| <h2>Construction</h2> | | <h2>Construction</h2> |
− | <p>OmpA_Gal d 2 fragment from IDT gblock was amplified by PCR using the high fidelity Phusion polymerase with primers IF3_allergen-F and IF4_Gal D2/DARPin-R. Expected size of the amplicon was 1675 bp.</p> | + | <p>The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lipoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197009">BBa_K1694009</a>).</p> |
| | | |
− | <p>pET-21 b (+) vector was linearized by PCR using the high fidelity Phusion polymerase with primers IF1_GalD2/DARPin-F and IF2_plasmid-R. Expected size of the amplicon was 5442 bp.</p>
| |
| | | |
− | <p>Amplification product sizes were checked on EtBr stained agarose gel (Figure 2).</p> | + | <h2>References</h2> |
| + | <p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p> |
| | | |
− | <figure class="normal mx-auto" style="width: 10vw;height: auto"> | + | <p>Other parts to display allergens:<br> |
− | <img
| + | - <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br> |
− | class="d-block"
| + | - <a href="https://parts.igem.org/Part:BBa_K4197007"> OmpA_Ana o 3</a> <br> |
− | src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/pet-21-b-linearized-and-gal-d-2-fragment.png" title= "Figure 1: pet lin and gal fragment" alt="Figure 2: pet lin and gal fragment" class="img-fluid"
| + | - <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Der p 1</a> <br> |
− | <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: pET-21 b (+) linearized (A) and Gal d 2 amplified fragment (B). Expected sizes of the amplicons were 5442 bp (A) and 1675 bp (B).</b> PCR amplicon sizes of pET-21 b (+) (A) and Gal d 2 (B) were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels. (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
| + | </p> |
− | </figure>
| + | |
| | | |
− | <p>Amplification products matched the expected size, they were further purified from gel.</p> | + | <ol> |
| + | <li>Dhanapala, P., Doran, T., Tang, M. L. K., & Suphioglu, C. (2015). Production and immunological analysis of IgE reactive recombinant egg white allergens expressed in Escherichia coli. Molecular Immunology, 65(1), 104–112. https://doi.org/10.1016/j.molimm.2015.01.006</li> |
| | | |
− | <p>The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone ( screening_inserts-F and screening_inserts-R, expected size of the amplicon : 2092 bp) (see <a href="https://2022.igem.wiki/toulouse-insa-ups/materials"><span class="gras orange">Primers List</span></a>). 2 positive transformants were detected (Figure 3).</p> | + | <li>Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954</li> |
| | | |
− | <figure class="normal mx-auto" style="width: 40vw;height: auto">
| |
− | <img
| |
− | class="d-block"
| |
− | src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/gal-d-2-screening.png" title= "Figure 2: gal screening" alt="Figure 2: gal screening" class="img-fluid"
| |
− | <figcaption class="normal"><span class="titre-image"><i><b>Figure 2: identifying fragments that bear pET21 b (+)_Ompa_Gal d 2 by colony PCR. Expected size of the amplicon was 2092 bp. The positive clones were colonies 17 and 24.</b> PCR amplicon sizes of colonies with Gal d 2 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
| |
− | </figure>
| |
− |
| |
− | <p>These transformants had their plasmid extracted by Miniprep and digested by EcoRV to assess the assembly (expected fragments at 4332 bp and 2785 bp, see Figure 4).</p>
| |
− |
| |
− | <figure class="normal mx-auto" style="width: 40vw;height: auto">
| |
− | <img
| |
− | class="d-block w-100"
| |
− | src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/gal-d-2-digestion.png" title= "Figure 3: gal digestion" alt="Figure 3: gal digestion" class="img-fluid"
| |
− | <figcaption class="normal"><span class="titre-image"><i><b>Figure 3: restriction profile of pET-21 b (+)_OmpA_Gal d 2 final construction. Enzyme used was EcoRV. Expected sizes of the amplicons were 4332 bp and 2785 bp.</b> Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
| |
− | </figure>
| |
− |
| |
− | <p>The correct restriction maps were obtained and the insert sequence was further validated by sequencing. The plasmid was named <b>pET-21 b (+)_OmpA_Gal d 2</b>. The plasmids were eventually used to transform <i>E. coli</i> Tuner cells in order to express the OmpA_Gal d 2 construction at the cell membrane.</p>
| |
− |
| |
− | <p>After cloning this first allergen, the plasmid obtained was used as a basis to build the other allergen constructions of our bank: Ara h 2, Der p 1 and Ana o 3.</p>
| |
− |
| |
− |
| |
− | <div class="center">
| |
− | <div class="thumb tnone">
| |
− | <div class="thumbinner" style="width:50%;">
| |
− | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
| |
− | <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption">
| |
− | <div class="magnify">
| |
− | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
| |
− | </div>
| |
− | <b>Figure 1: </b> <b>Xxxxxx</b>
| |
− | Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
| |
− | </div>
| |
− | </div>
| |
− | </div>
| |
− | </div>
| |
− | <h2>Xxxxxxxxx</h2>
| |
− | <p>Xxxxxxxxxxxxx</p>
| |
− | <div class="center">
| |
− | <div class="thumb tnone">
| |
− | <div class="thumbinner" style="width:80%;">
| |
− | <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
| |
− | <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption">
| |
− | <div class="magnify">
| |
− | <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
| |
− | </div>
| |
− | <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b>
| |
− | Xxxxxxxxxxxxx.
| |
− | </div>
| |
− | </div>
| |
− | </div>
| |
− | </div>
| |
− |
| |
− | <h2>titre 2</h2>
| |
− | <h3>Titre 3</h3>
| |
− | <p>Xxxxxxxxxx</p>
| |
− | <ul>
| |
− | <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
| |
− | <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
| |
− | </ul>
| |
− | <p>Xxxxxxxxxx</p>
| |
− | <ul>
| |
− | <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
| |
− | <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
| |
− | </ul>
| |
− |
| |
− |
| |
− | <h3>titre 3</h3>
| |
− | <h4>Titre 4</h4>
| |
− | <p>Xxxxxx</p>
| |
− |
| |
− |
| |
− | <h4>Titre 4</h4>
| |
− | <p>xxxxxxx</p>
| |
− |
| |
− | <h2>Titre 2</h2>
| |
− | <p>Xxxxxx</p>
| |
− | <h2>References</h2>
| |
− | <ol>
| |
− | <i>
| |
− | <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
| |
− | <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
| |
− | <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
| |
− | </i>
| |
| </ol> | | </ol> |
| </html> | | </html> |
This part is composed of the gene coding for the allergen of hen’s egg Gal d 2 (NCBI: V00383.1). The hen's egg allergy prevalence is 0,5-2,5% in developed countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in E. coli and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015).
The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of E. coli so the ordered sequence was merged to OmpA membrane lipoprotein (see part BBa_K1694009).