Difference between revisions of "Part:BBa K4508000"
 
(8 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K4508000 short</partinfo>
 
<partinfo>BBa_K4508000 short</partinfo>
  
−
Primers designed for the HSP65 gene of Mycobacterium smegmatis were designed for Recombinase Polymerase Amplification (RPA) of the Heat shock protein 65 gene belonging to M.smegmatis.
+
Forward primer of HSP65 was designed for Recombinase Polymerase Amplification (RPA) of the Heat shock protein 65 gene belonging to Mycobacterium smegmatis.
 +
 
 +
Designed alongside reverse primer: <html>
 +
      <p>
 +
        <a href="https://parts.igem.org/Part:BBa_K4508001">BBa_K4508001</a>
 +
      </p>
 +
  </body>
 +
</html>
  
−
===Usage and Biology===
 
  
 
===<h2 style="font-weight: bold;">Information contributed by City of London UK (2022)</h2>===
 
===<h2 style="font-weight: bold;">Information contributed by City of London UK (2022)</h2>===
Line 15: Line 21:
 
*'''Summary:''' Added information collated from existing scientific studies
 
*'''Summary:''' Added information collated from existing scientific studies
  
−
Primers are short single-stranded DNA sequences that are used as starting points that direct DNA polymerase to where DNA synthesis should take place. We are using our Primer as a starting point for RPA amplification. RPA amplification is a highly sensitive technique that is able to amplify as low as 1-10 DNA target copies. This makes it ideal for tuberculosis due to the low quantity M. tuberculosis present in the breath of someone positive for TB. Therefore, we will use our primer to amplify the hsp65 gene present in M. tuberculosis. Since the optimum temperature for RPA amplification is 37-42 degrees, the primer should also operate at these temperatures; our primer has a melting point of 60 degrees. Furthermore, it is not recommended to have a GC content lower than 30% or higher than 70%, which is why our primer has a GC content of 50%. When ATP and a crowding agent is then present, the recombinase protein uvsX will bind to our forward (ATTGCGTACGACGAAGAGGCCC) and reverse (GTCCTCGGCGATGATCAGCAGC) primers and form a recombinase-primer complex, which then searches for homologous sequences in the DNA. The primers are then inserted into the cognate site by the strand-displacement activity of the recombinase and the displaced DNA strands are than stabilised by single stranded binding proteins which prevent branch migration from occurring, removing the inserted primer. Then the recombinase disassembles and the 3’-end of the primers is made accessible allowing a strand to displace DNA polymerase and elongate the primer. Cyclic repetition of this process is what allows exponential amplification to be achieved. These genes would then start to pass through the time delay and be detected by the CRISPR Cas12a-SHERLOCK.
+
===Usage and Biology===
 +
 
 +
Primers are short single-stranded DNA sequences that are used as starting points that direct DNA polymerase to where DNA synthesis should take place. We are using our Primer as a starting point for RPA amplification. RPA amplification is a highly sensitive technique that is able to amplify as low as 1-10 DNA target copies.<ref>Lobato, I. and O'Sullivan, C., 2018. Recombinase polymerase amplification: Basics, applications and recent advances. TrAC Trends in Analytical Chemistry, 98, pp.19-35.</ref> This makes it ideal for tuberculosis due to the low quantity M. tuberculosis present in the breath of someone positive for TB. Therefore, we will use our primer to amplify the hsp65 gene present in M. tuberculosis. Since the optimum temperature for RPA amplification is 37-42 degrees, the primer should also operate at these temperatures; our primer has a melting point of 60 degrees. Furthermore, it is not recommended to have a GC content lower than 30% or higher than 70%, which is why our primer has a GC content of 50%. When ATP and a crowding agent is then present, the recombinase protein uvsX will bind to our forward (sequence shown below) and reverse primers and form a recombinase-primer complex, which then searches for homologous sequences in the DNA. The primers are then inserted into the cognate site by the strand-displacement activity of the recombinase and the displaced DNA strands are than stabilised by single stranded binding proteins which prevent branch migration from occurring, removing the inserted primer. Then the recombinase disassembles and the 3’-end of the primers is made accessible allowing a strand to displace DNA polymerase and elongate the primer. Cyclic repetition of this process is what allows exponential amplification to be achieved. These genes would then start to pass through the time delay and be detected by the CRISPR Cas12a-SHERLOCK.<ref>Biolabs, N., 2022. [online] International.neb.com. Available at: <https://international.neb.com/applications/dna-amplification-pcr-and-qpcr/isothermal-amplification/recombinase-polymerase-amplification-and-strand-invasion-based-amplification> [Accessed 5 October 2022].</ref>
 +
 
 +
 
 +
<html>
 +
<img src="https://ars.els-cdn.com/content/image/1-s2.0-S0165993617302583-gr1.jpg" style="width:60%">
 +
</html>
 +
Figure 1. Illustration of RPA Cycle <ref>Lobato, I. and O'Sullivan, C., 2018. Recombinase polymerase amplification: Basics, applications and recent advances. TrAC Trends in Analytical Chemistry, 98, pp.19-35.</ref>
  
  

Latest revision as of 11:00, 6 October 2022


HSP65 Forward Primer (M.smegmatis)

Forward primer of HSP65 was designed for Recombinase Polymerase Amplification (RPA) of the Heat shock protein 65 gene belonging to Mycobacterium smegmatis.

Designed alongside reverse primer:

BBa_K4508001


Information contributed by City of London UK (2022)

Part information is collated here to help future users of the BioBrick registry.

Metadata:

  • Group: City of London UK 2022
  • Author: Yamini Sivaraman
  • Summary: Added information collated from existing scientific studies

Usage and Biology

Primers are short single-stranded DNA sequences that are used as starting points that direct DNA polymerase to where DNA synthesis should take place. We are using our Primer as a starting point for RPA amplification. RPA amplification is a highly sensitive technique that is able to amplify as low as 1-10 DNA target copies.[1] This makes it ideal for tuberculosis due to the low quantity M. tuberculosis present in the breath of someone positive for TB. Therefore, we will use our primer to amplify the hsp65 gene present in M. tuberculosis. Since the optimum temperature for RPA amplification is 37-42 degrees, the primer should also operate at these temperatures; our primer has a melting point of 60 degrees. Furthermore, it is not recommended to have a GC content lower than 30% or higher than 70%, which is why our primer has a GC content of 50%. When ATP and a crowding agent is then present, the recombinase protein uvsX will bind to our forward (sequence shown below) and reverse primers and form a recombinase-primer complex, which then searches for homologous sequences in the DNA. The primers are then inserted into the cognate site by the strand-displacement activity of the recombinase and the displaced DNA strands are than stabilised by single stranded binding proteins which prevent branch migration from occurring, removing the inserted primer. Then the recombinase disassembles and the 3’-end of the primers is made accessible allowing a strand to displace DNA polymerase and elongate the primer. Cyclic repetition of this process is what allows exponential amplification to be achieved. These genes would then start to pass through the time delay and be detected by the CRISPR Cas12a-SHERLOCK.[2]


Figure 1. Illustration of RPA Cycle [3]



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 6
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


  1. ↑ Lobato, I. and O'Sullivan, C., 2018. Recombinase polymerase amplification: Basics, applications and recent advances. TrAC Trends in Analytical Chemistry, 98, pp.19-35.
  2. ↑ Biolabs, N., 2022. [online] International.neb.com. Available at: <https://international.neb.com/applications/dna-amplification-pcr-and-qpcr/isothermal-amplification/recombinase-polymerase-amplification-and-strand-invasion-based-amplification> [Accessed 5 October 2022].
  3. ↑ Lobato, I. and O'Sullivan, C., 2018. Recombinase polymerase amplification: Basics, applications and recent advances. TrAC Trends in Analytical Chemistry, 98, pp.19-35.