Latest revision as of 09:38, 12 October 2022

SDM1 Forward Primer for pCT5c Mutation

Description

This primer is designed for mutating the BsaI site 1 in pCT5-bac 2.0. This part is a forward primer with a mutation nucleotide, changing c to g.

Figure 1: pCT5-bac 2.0 with primers for site directed mutagenesis at position 647.

Usage and Biology

• This part is used in site directed mutagenesis of pCT5c (Part: BBa_K4417000).
• Sequence: tgccctgggtttccattgcgc
• Length: 21-mer
• Tm: 61℃
• GC content: 62%

Figure 2: Binding site of SDM1_Fw.

Method

This part is used with BBa_K4417000 and BBa_K4417002. A detailed protocol is described in BBa_K4417000.

Characterization

This primer will remove one BsaI site, leaving another two BsaI sites. The KLD product was transformed into DH5-α, and the plasmid was checked using a diagnostic digest. From Figure 3, the expected band size can be identified in lanes 2, 7, 11, and 15.

Figure 3: Comparative gel for pCT5c site directed mutagenesis; 1: HyperLadder^TM 1kb, 2: pCT5-bac 2.0 uncut, 3: SDM1 uncut, 4: SDM1,3 uncut, 5: pCT5c uncut, 6: pCT5c cut with BsaI (3481bp, 2344bp, 2052bp), 7: SDM1 cut with BsaI (4396bp, 3481bp), 8: SDM1,3 cut with BsaI (7877bp), 9: pCT5c cut with BsaI, 10: pCT5-bac 2.0 cut with BamHI/SacI (6851bp, 1026bp), 11: SDM1 cut with BamHI/SacI (6851bp, 1026bp), 12: SDM1,3 cut with BamHI/SacI (6851bp, 1026bp), 13: pCT5c cut with BamHI/SacI (6851bp, 1026bp), 14: pCT5-bac 2.0 cut with BamHI/BsaI (3481bp, 2087bp, 2052bp, 257bp), 15: SDM1 cut with BamHI/BsaI (3481bp, 2309bp, 2087bp), 16: SDM1,3 cut with BamHI/BsaI (5790bp, 2087bp), 17: pCT5c cut with BamHI/BsaI, 18: HyperLadder^TM 1kb.

Conclusion

This part has high efficiency and quality in site directed mutagenesis.

Sequence and Features