|
|
| (14 intermediate revisions by 3 users not shown) |
| Line 1: |
Line 1: |
| − | ATGCCAAAGAAGAAGAGAAAGGTTGCTCCACCAACCGACGTTTCCTTGGGTGACGAATTGCACTTGGACGGTGAAGATGTTGCTATGGCTCACGCTGACGCTTTGGACGACTTTGACTTGGATATGTTGGGTGATGGAGATTCTCCAGGTCCAGGTTTTACTCCTCATGATTCTGCTCCATACGGTGCTTTGGATATGGCTGATTTTGAATTTGAACAAATGTTCACTGACGCTTTGGGTATTGATGAATACGGTGGTGGTGCTGATGATACTAGAGTTGAAGTTCAGCCTCCTGCTCAATGGGTTTTGGATTTGATTGAGGCTTCTCCTATTGCTTCTGTTGTTTCTGATCCTAGATTGGCTGATAACCCATTGATTGCTATTAACCAAGCTTTTACTGATTTGACTGGTTACTCCGAAGAGGAATGTGTTGGTAGAAATTGTAGATTTTTGGCTGGTTCTGGTACTGAACCATGGTTGACTGATAAAATTAGACAAGGAGTTAGAGAACATAAGCCAGTTTTGGTTGAAATTTTGAACTACAAGAAGGATGGTACCCCTTTTAGAAACGCTGTTTTGGTTGCTCCAATTTATGATGACGATGATGAGTTGTTGTACTTTTTGGGTTCTCAAGTTGAGGTTGATGATGACCAGCCAAACATGGGTATGGCTAGAAGAGAGAGAGCTGCTGAGATGTTGAGAACCTTGTCTCCAAGACAATTGGAAGTTACTACTTTGGTTGCTTCCGGTTTGAGAAATAAGGAGGTTGCTGCTAGATTGGGTTTGTCTGAAAAGACTGTTAAGATGCATAGAGGTTTGGTTATGGAAAAGTTGAACTTGAAGACTTCTGCTGATTTGGTTAGAATTGCTGTTGAAGCTGGTATTTAA
| + | <html lang="en"> |
| | + | <head> |
| | + | <meta charset="UTF-8"> |
| | + | <meta http-equiv="X-UA-Compatible" content="IE=edge"> |
| | + | <meta name="viewport" content="width=device-width, initial-scale=1.0"> |
| | + | <title>K4263009</title> |
| | + | <link rel="stylesheet" href="https://2022.igem.wiki/scut-china/static/css/part-public.css"> |
| | + | </head> |
| | + | <body> |
| | + | <article> |
| | + | <h2 style="font-weight: bold;">SV40-VP16-EL222</h2> |
| | + | <h2>Usage</h2> |
| | + | <p>Inspired from certain parts in the database and a recent literature which demonstrated the application of a blue light-induced system in <em>P.pastoris</em>, we established blue light control system. A constitutive or inducible promoter and its downstream gene that encoded light-activated transcriptional factor protein EL222, SV40-VP16-EL222. EL222 is expressed as monomer, and turn to dimer as the blue light (465 nm) was on. Then, activated EL222 binds to the (C120)<sub>5</sub> region and initiate the expression of our target gene, <em>PTS</em> (Figure.1).</p> |
| | + | <img src="https://static.igem.wiki/teams/4263/wiki/parts/image/fig-1-min.png" alt="" style="width: 30%;margin-bottom:5px;"> |
| | + | <h4>Figure 1. Design of the optogenetic plasmid.</h4> |
| | + | <img src="https://static.igem.wiki/teams/4263/wiki/parts/image/fig-2-min.png" alt="" style="margin:0;margin-left:18%;"> |
| | + | <h4>Figure 2. Gel electrophoresis result of colony PCR to detect the insertion of BBa_K4263009 and BBa_K4263010 into engineered <em>P.pastoris</em> yeast 2OZPP. (The engineered yeast 2OZPP has the ability to express the lycopene synthetic genes from Corynebacterium glutamicum ATCC13032 with the PAOX1 promoter into <em>P.pastoris</em> strain GS115.) A target band around 2399 bp should appear to indicate a successful construction, which was shown as marked.</h4> |
| | + | |
| | + | <h2>Biology</h2> |
| | + | <p>The photosensitive protein EL222 from <em>Erythrobacter litoralis</em> is one of the systems based on light-induced homodimerization. It is composed of 222 amino acids (aa). The N-terminal of EL222 is a light-oxygen-voltage (LOV) domain, and the C-terminal is a helix-turn-helix (HTH) DNA binding domain. The Jα helix links the LOV and HTH. When EL222 is irradiated by blue light, the combination of flavin mononucleotide (FMN) and LOV causes the Jα helix to wobble away from LOV, thereby releasing HTH, which makes EL222 homodimerize and bind to the regulatory element termed clone 1-20 bp (C120).</p> |
| | + | |
| | + | <h2>Experiment</h2> |
| | + | <p>We synthesized and constructed the parts on the same vector pPIcza. Four groups of our host, three parallel tests each, are set with difference in the promoter which control the expression of EL222 in 250ml shake flasks. All of the flasks are cultured for 48h, and their OD were checked every 24h, then methanol was added. </p> |
| | + | <p>Blue light was sprayed by LEDs (5W, 465 nm) that are hanging above the flasks. The OD value and the titer from each parallel is examined by GC and HPLC, and we were aware that lycopene and patchulol were produced when blue light on, which means our blue light-induced system is able to work effectively. Besides, the expression level was related to the dose of the blue light. The longer exposure to blue light, the higher titer of patchulol. (Figure.3)</p> |
| | + | <p>Beside, Sequence optimization of our dynamically regulated light-control part <a href="https://parts.igem.org/Part:BBa_K4263009">BBa_K4263009</a> was done to allow it to better play a regulatory role in <em>P.pastoris</em>.(reference to the existed part <a href="https://parts.igem.org/Part:BBa_K3570021">BBa K3570021</a><sup>[2]</sup>)</p> |
| | + | |
| | + | |
| | + | <img src="https://static.igem.wiki/teams/4263/wiki/parts/image/fig-3-min.png" alt=""> |
| | + | <h4>Figure 3. Titer of lycopene and patchulol of each parallel.</h4> |
| | + | |
| | + | |
| | + | <h2>Reference</h2> |
| | + | <p>[1]Zhiqian Wang, Yunjun Yan, and Houjin Zhang ACS Synthetic Biology 2022 11 (1), 297-307 DOI: 10.1021/acssynbio.1c00422</p> |
| | + | <p>[2] <a href="https://parts.igem.org/Part:BBa_K3570021">Part:BBa K3570021 - parts.igem.org</a></p> |
| | + | </article> |
| | + | </body> |
| | + | </html> |
| | + | |
| | + | <span class='h3bb'>Sequence and Features</span> |
| | + | <partinfo>BBa_K4263009 SequenceAndFeatures</partinfo> |
| | + | |
| | + | <!-- Uncomment this to enable Functional Parameter display |
| | + | ===Functional Parameters=== |
| | + | <partinfo>BBa_K4263009 parameters</partinfo> |
SV40-VP16-EL222
Usage
Inspired from certain parts in the database and a recent literature which demonstrated the application of a blue light-induced system in P.pastoris, we established blue light control system. A constitutive or inducible promoter and its downstream gene that encoded light-activated transcriptional factor protein EL222, SV40-VP16-EL222. EL222 is expressed as monomer, and turn to dimer as the blue light (465 nm) was on. Then, activated EL222 binds to the (C120)5 region and initiate the expression of our target gene, PTS (Figure.1).
Figure 1. Design of the optogenetic plasmid.
Figure 2. Gel electrophoresis result of colony PCR to detect the insertion of BBa_K4263009 and BBa_K4263010 into engineered P.pastoris yeast 2OZPP. (The engineered yeast 2OZPP has the ability to express the lycopene synthetic genes from Corynebacterium glutamicum ATCC13032 with the PAOX1 promoter into P.pastoris strain GS115.) A target band around 2399 bp should appear to indicate a successful construction, which was shown as marked.
Biology
The photosensitive protein EL222 from Erythrobacter litoralis is one of the systems based on light-induced homodimerization. It is composed of 222 amino acids (aa). The N-terminal of EL222 is a light-oxygen-voltage (LOV) domain, and the C-terminal is a helix-turn-helix (HTH) DNA binding domain. The Jα helix links the LOV and HTH. When EL222 is irradiated by blue light, the combination of flavin mononucleotide (FMN) and LOV causes the Jα helix to wobble away from LOV, thereby releasing HTH, which makes EL222 homodimerize and bind to the regulatory element termed clone 1-20 bp (C120).
Experiment
We synthesized and constructed the parts on the same vector pPIcza. Four groups of our host, three parallel tests each, are set with difference in the promoter which control the expression of EL222 in 250ml shake flasks. All of the flasks are cultured for 48h, and their OD were checked every 24h, then methanol was added.
Blue light was sprayed by LEDs (5W, 465 nm) that are hanging above the flasks. The OD value and the titer from each parallel is examined by GC and HPLC, and we were aware that lycopene and patchulol were produced when blue light on, which means our blue light-induced system is able to work effectively. Besides, the expression level was related to the dose of the blue light. The longer exposure to blue light, the higher titer of patchulol. (Figure.3)
Beside, Sequence optimization of our dynamically regulated light-control part BBa_K4263009 was done to allow it to better play a regulatory role in P.pastoris.(reference to the existed part BBa K3570021[2])
Figure 3. Titer of lycopene and patchulol of each parallel.
Reference
[1]Zhiqian Wang, Yunjun Yan, and Houjin Zhang ACS Synthetic Biology 2022 11 (1), 297-307 DOI: 10.1021/acssynbio.1c00422
[2] Part:BBa K3570021 - parts.igem.org
