Difference between revisions of "Part:BBa K4197012"
 
(5 intermediate revisions by 3 users not shown)
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197012 short</partinfo>
 
<partinfo>BBa_K4197012 short</partinfo>
  
−
Gene coding for mScarlet-I with ihfB800 promoter
+
Red fluorescent protein mRFP1 expressed from a constitutive promoter of <i>E. coli</i>.
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the mRFP1 red fluorescent protein (given by Manon Barthe, a researcher at Toulouse Biotechnology Institute), under control of the 800 first base pairs of the <i>ihfB</i> promoter (see <a href="https://parts.igem.org/Part:BBa_K4197014">BBa_K4197014</a>. This promoter has been identified as constitutive <i>E. coli</i> promoter (Weglenska et al., 1996). It was used for constitutive expression of fluorescent proteins in <i>E. coli</i> (Barthe et al., 2020) and appears as strong enough to permit sufficient expression of mRFP1 without inclusion bodies.</p>
 +
 
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
 
−
   
 
  
−
<div class="center">
+
<p>The objective of the INSA-UPS 2022 team was to use the ihfB800 promoter to express mRFP1 into <i>E. coli</i> Tuner (DE3) cells. Unfortunately, expression of the fluorescent protein was not successful (see <a href="https://parts.igem.org/Part:BBa_K4197003">BBa_K4197003</a>).
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
+
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 1: </b> <b>Xxxxxx</b>
+
−
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<h2>Xxxxxxxxx</h2>
+
−
<p>Xxxxxxxxxxxxx</p>
+
−
<div class="center">
+
−
    <div class="thumb tnone">
+
−
        <div class="thumbinner" style="width:80%;">
+
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
+
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                <div class="magnify">
+
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
+
−
                </div>
+
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
+
−
                Xxxxxxxxxxxxx.
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
</div>
+
−
   
+
−
<h2>titre 2</h2>
+
−
<h3>Titre 3</h3>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
  
 +
<h2>References</h2>
  
−
<h3>titre 3</h3>
+
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
−
    <h4>Titre 4</h4>
+
−
<p>Xxxxxx</p>
+
  
−
                 
+
<p>Other parts of fluorescent proteins with ihfB800:<br>
−
<h4>Titre 4</h4>
+
 
−
<p>xxxxxxx</p>
+
- <a href="https://parts.igem.org/Part:BBa_K4197013">mTagBFP</a><br>
 +
- <a href="https://parts.igem.org/Part:BBa_K4197022">mScarlet-I</a><br>
 +
</p>
  
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
−
<h2>References</h2>
 
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
     <li>Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4</li>
−
     <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
     <li>Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20</i>
−
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
−
</i>
+
 
</ol>
 
</ol>
 
</html>
 
</html>

Latest revision as of 18:00, 8 October 2022

mRFP1 under control of ihfB800 promoter

Red fluorescent protein mRFP1 expressed from a constitutive promoter of E. coli.

Introduction

This part is composed of the gene coding for the mRFP1 red fluorescent protein (given by Manon Barthe, a researcher at Toulouse Biotechnology Institute), under control of the 800 first base pairs of the ihfB promoter (see BBa_K4197014. This promoter has been identified as constitutive E. coli promoter (Weglenska et al., 1996). It was used for constitutive expression of fluorescent proteins in E. coli (Barthe et al., 2020) and appears as strong enough to permit sufficient expression of mRFP1 without inclusion bodies.

Construction

The objective of the INSA-UPS 2022 team was to use the ihfB800 promoter to express mRFP1 into E. coli Tuner (DE3) cells. Unfortunately, expression of the fluorescent protein was not successful (see BBa_K4197003).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts of fluorescent proteins with ihfB800:
- mTagBFP
- mScarlet-I

  1. Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4
  2. Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1526
    Illegal XbaI site found at 1511
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1526
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1518
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1526
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1526
    Illegal XbaI site found at 1511
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1526
    Illegal XbaI site found at 1511
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1359
    Illegal AgeI site found at 1471
  • 1000
    COMPATIBLE WITH RFC[1000]