Difference between revisions of "Part:BBa K4197015"
 
(3 intermediate revisions by 2 users not shown)
Line 8: Line 8:
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the allergen of dust mite Der p 1 (NCBI: <a "https://www.ncbi.nlm.nih.gov/nuccore/U11695.1/">U11695.1</a>). The mite allergy prevalence is 20% (Lieberman and al. 2018) in the US and Der p 1 triggers 87% of dust mite allergies (Mueller and al. 2015). Der p 1 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with peanut's allergie (Bussières and al. 2010). </p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
 
−
   
 
  
−
<div class="center">
+
<p>The objective of the INSA-UPS 2022 team was to display Der p 1 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lipoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197006">BBa_K1694006</a>).</p>
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
+
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 1: </b> <b>Xxxxxx</b>
+
−
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<h2>Xxxxxxxxx</h2>
+
−
<p>Xxxxxxxxxxxxx</p>
+
−
<div class="center">
+
−
    <div class="thumb tnone">
+
−
        <div class="thumbinner" style="width:80%;">
+
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
+
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                <div class="magnify">
+
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
+
−
                </div>
+
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
+
−
                Xxxxxxxxxxxxx.
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
</div>
+
−
   
+
−
<h2>titre 2</h2>
+
−
<h3>Titre 3</h3>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
  
  
−
<h3>titre 3</h3>
+
<h2>References</h2>
−
    <h4>Titre 4</h4>
+
−
<p>Xxxxxx</p>
+
  
−
                 
+
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
−
<h4>Titre 4</h4>
+
 
−
<p>xxxxxxx</p>
+
<p>Other parts to display allergens:<br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197007"> OmpA_Ana o 3</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197009"> OmpA_Gal d 2</a> <br>
 +
</p>
  
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
−
<h2>References</h2>
 
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
    <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
 
−
    <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
    <li>Mueller, G. A.; Randall, T. A.; Glesner, J.; Pedersen, L. C.; Perera, L.; Edwards, L. L.; DeRose, E. F.; Chapman, M. D.; London, R. E.; Pomés, A. (2016). Serological, genomic and structural analyses of the major mite allergen Der p 23. Clinical & Experimental Allergy, 46(2), 365–376. doi:10.1111/cea.12680 </li>
−
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
 
 +
 
 +
  <li>Bussières, L., Bordas-Le Floch, V., Bulder, I., Chabre, H., Nony, E., Lautrette, A., Berrouet, C., Nguefeu, Y., Horiot, S., Baron-Bodo, V., Van Overtvelt, L., De Conti, A. M., Schlegel, A., Maguet, N., Mouz, N., Lemoine, P., Batard, T., & Moingeon, P. (2010). Recombinant Fusion Proteins Assembling Der p 1 and Der p 2 Allergens from Dermatophagoides pteronyssinus. International Archives of Allergy and Immunology, 153(2), 141–151. https://doi.org/10.1159/000312631 </li>
 
</i>
 
</i>
 
</ol>
 
</ol>

Latest revision as of 08:24, 8 October 2022


Gene coding for Der p 1

Gene coding for Mite allergen called Der p 1.

Introduction

This part is composed of the gene coding for the allergen of dust mite Der p 1 (NCBI: U11695.1). The mite allergy prevalence is 20% (Lieberman and al. 2018) in the US and Der p 1 triggers 87% of dust mite allergies (Mueller and al. 2015). Der p 1 have already been expressed in E. coli and was able to bind the IgE of patient with peanut's allergie (Bussières and al. 2010).

Construction

The objective of the INSA-UPS 2022 team was to display Der p 1 on the surface of E. coli so the ordered sequence was merged to OmpA membrane lipoprotein (see part BBa_K1694006).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Ana o 3
- OmpA_Gal d 2

  1. Mueller, G. A.; Randall, T. A.; Glesner, J.; Pedersen, L. C.; Perera, L.; Edwards, L. L.; DeRose, E. F.; Chapman, M. D.; London, R. E.; Pomés, A. (2016). Serological, genomic and structural analyses of the major mite allergen Der p 23. Clinical & Experimental Allergy, 46(2), 365–376. doi:10.1111/cea.12680
  2. Bussières, L., Bordas-Le Floch, V., Bulder, I., Chabre, H., Nony, E., Lautrette, A., Berrouet, C., Nguefeu, Y., Horiot, S., Baron-Bodo, V., Van Overtvelt, L., De Conti, A. M., Schlegel, A., Maguet, N., Mouz, N., Lemoine, P., Batard, T., & Moingeon, P. (2010). Recombinant Fusion Proteins Assembling Der p 1 and Der p 2 Allergens from Dermatophagoides pteronyssinus. International Archives of Allergy and Immunology, 153(2), 141–151. https://doi.org/10.1159/000312631


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]