Difference between revisions of "Part:BBa K4197016"

 
(One intermediate revision by one other user not shown)
Line 7: Line 7:
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: <a "https://www.ncbi.nlm.nih.gov/protein/AAL91665.1/">AAL91665.1</a>). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy  (Sato and al. 2019). Ana o 3 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).</p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>The objective of the INSA-UPS 2022 team was to display Ana o 3 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lipoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197007">BBa_K4197007</a>).</p>
   
+
  
<div class="center">
 
        <div class="thumb tnone">
 
            <div class="thumbinner" style="width:50%;">
 
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
 
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
                    <div class="magnify">
 
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
                    </div>
 
                    <b>Figure 1: </b> <b>Xxxxxx</b> 
 
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
 
                </div>
 
            </div>
 
        </div>
 
    </div>
 
<h2>Xxxxxxxxx</h2>
 
<p>Xxxxxxxxxxxxx</p>
 
<div class="center">
 
    <div class="thumb tnone">
 
        <div class="thumbinner" style="width:80%;">
 
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
 
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
                <div class="magnify">
 
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
 
                </div>
 
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
 
                Xxxxxxxxxxxxx.
 
            </div>
 
        </div>
 
    </div>
 
</div>
 
   
 
<h2>titre 2</h2>
 
<h3>Titre 3</h3>
 
<p>Xxxxxxxxxx</p>
 
<ul>
 
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
 
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
 
</ul>
 
<p>Xxxxxxxxxx</p>
 
<ul>
 
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
 
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
 
</ul>
 
  
 +
<h2>References</h2>
 +
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
  
<h3>titre 3</h3>
+
<p>Other parts to display allergens:<br>
     <h4>Titre 4</h4>
+
     - <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>
<p>Xxxxxx</p>
+
    - <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Der p 2</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197009"> OmpA_Gal d 2</a> <br>
 +
</p>
  
                 
 
<h4>Titre 4</h4>
 
<p>xxxxxxx</p>
 
 
<h2>Titre 2</h2>
 
<p>Xxxxxx</p>
 
<h2>References</h2>
 
 
<ol>
 
<ol>
 
     <i>
 
     <i>
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
 
     <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
 
     <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
     <li>Van der Valk, J. P. M., J. Dubois, A. E., Gerth van Wijk, R., Wichers, H. J., de Jong, N. W. (2014). Systematic review on cashew nut allergy. Allergy. 69(6), 692–698. doi:10.1111/all.12401 </li>
 +
 
 +
     <li>Sato, S., Movérare, R., Ohya, Y., Ito, K., Nagao, M., Borres, M. P., & Ebisawa, M. (2019). Ana o 3–specific IgE is a predictive marker for cashew oral food challenge failure. The Journal of Allergy and Clinical Immunology : In Practice, 7(8), 2909–2911.e4. https://doi.org/10.1016/j.jaip.2019.04.049</li>
 +
 
 +
     <li>Robotham, J. M., Wang, F., Seamon, V., Teuber, S. S., Sathe, S. K., Sampson, H. A., Beyer, K., Seavy, M., & Roux, K. H. (2005). Ana o 3, an important cashew nut (Anacardium occidentale L.) allergen of the 2S albumin family. Journal of Allergy and Clinical Immunology, 115(6), 1284–1290.</li>
 +
 
 +
   
 
</i>
 
</i>
 
</ol>
 
</ol>

Latest revision as of 07:51, 8 October 2022


Gene coding for Ana o 3

Gene coding for the cashew allergen called Ana o 3.

Introduction

This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: AAL91665.1). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy (Sato and al. 2019). Ana o 3 have already been expressed in E. coli and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).

Construction

The objective of the INSA-UPS 2022 team was to display Ana o 3 on the surface of E. coli so the ordered sequence was merged to OmpA membrane lipoprotein (see part BBa_K4197007).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Der p 2
- OmpA_Gal d 2

  1. Van der Valk, J. P. M., J. Dubois, A. E., Gerth van Wijk, R., Wichers, H. J., de Jong, N. W. (2014). Systematic review on cashew nut allergy. Allergy. 69(6), 692–698. doi:10.1111/all.12401
  2. Sato, S., Movérare, R., Ohya, Y., Ito, K., Nagao, M., Borres, M. P., & Ebisawa, M. (2019). Ana o 3–specific IgE is a predictive marker for cashew oral food challenge failure. The Journal of Allergy and Clinical Immunology : In Practice, 7(8), 2909–2911.e4. https://doi.org/10.1016/j.jaip.2019.04.049
  3. Robotham, J. M., Wang, F., Seamon, V., Teuber, S. S., Sathe, S. K., Sampson, H. A., Beyer, K., Seavy, M., & Roux, K. H. (2005). Ana o 3, an important cashew nut (Anacardium occidentale L.) allergen of the 2S albumin family. Journal of Allergy and Clinical Immunology, 115(6), 1284–1290.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 130