Difference between revisions of "Part:BBa K4370011:Design"
(→References) |
|||
(4 intermediate revisions by the same user not shown) | |||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
− | This sequence has been designed to target different strains such as <i> S. ambofaciens </i> ATCC 23877, <i> S. bottropensis </i> ATCC 25435, <i> S. venezuelae </i> ATCC 10712 and <i> S. rimosus </i> ATCC 10970. The part is also designed to be cloned between NcoI and SnaBI sites into the pCRISPR-dCas9 plasmid published by Tong and collaborators (ACS Synthetic Biology, 2015). This plasmid encodes a dead version of Cas9 that can be used to silence gene expression at specific loci. Twenty nucl. (ACCTGAACCTTCTGTGCCAC) are perfect the beginning of lsr2A gene, the following nucleotide. (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT) correspond to the gRNA scaffold. | + | This sequence has been designed to target <i> lsr2A </i> gene in different strains such as <i> S. ambofaciens </i> ATCC 23877, <i> S. bottropensis </i> ATCC 25435, <i> S. venezuelae </i> ATCC 10712 and <i> S. rimosus </i> ATCC 10970. The part is also designed to be cloned between NcoI (CCATGG) and SnaBI (TACGTA) sites into the pCRISPR-dCas9 plasmid published by Tong and collaborators (ACS Synthetic Biology, 2015). This plasmid encodes a dead version of Cas9 that can be used to silence gene expression at specific loci. Twenty nucl. (ACCTGAACCTTCTGTGCCAC) are perfect the beginning of lsr2A gene, the following nucleotide. (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT) correspond to the gRNA scaffold. |
Please have a look to our CRISPRi tuto to learn more about the way to design sgRNA for gene expression silencing in bacteria. | Please have a look to our CRISPRi tuto to learn more about the way to design sgRNA for gene expression silencing in bacteria. | ||
− | |||
− | |||
===Source=== | ===Source=== | ||
Line 18: | Line 16: | ||
===References=== | ===References=== | ||
+ | Yaojun Tong, Pep Charusanti, Lixin Zhan, Tilmann Weber, and Sang Yup Lee, “CRISPR-Cas9 Based Engineering of Actinomycetal Genomes”, ACS Synth. Biol. 2015, 4, 9, 1020–1029 | ||
+ | |||
+ | https://doi.org/10.1021/acssynbio.5b00038 | ||
+ | |||
+ | Designed using our CRISPRi tuto. |
Latest revision as of 08:09, 22 August 2022
sgRNA_lsr2A_STREPTO
- 10INCOMPATIBLE WITH RFC[10]Unknown
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Unknown
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
This sequence has been designed to target lsr2A gene in different strains such as S. ambofaciens ATCC 23877, S. bottropensis ATCC 25435, S. venezuelae ATCC 10712 and S. rimosus ATCC 10970. The part is also designed to be cloned between NcoI (CCATGG) and SnaBI (TACGTA) sites into the pCRISPR-dCas9 plasmid published by Tong and collaborators (ACS Synthetic Biology, 2015). This plasmid encodes a dead version of Cas9 that can be used to silence gene expression at specific loci. Twenty nucl. (ACCTGAACCTTCTGTGCCAC) are perfect the beginning of lsr2A gene, the following nucleotide. (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT) correspond to the gRNA scaffold.
Please have a look to our CRISPRi tuto to learn more about the way to design sgRNA for gene expression silencing in bacteria.
Source
The sequence has been synthetized.
References
Yaojun Tong, Pep Charusanti, Lixin Zhan, Tilmann Weber, and Sang Yup Lee, “CRISPR-Cas9 Based Engineering of Actinomycetal Genomes”, ACS Synth. Biol. 2015, 4, 9, 1020–1029
https://doi.org/10.1021/acssynbio.5b00038
Designed using our CRISPRi tuto.