Difference between revisions of "Part:BBa K3844003:Sequence, Features, and Subparts"

(Created page with "==1. Function== This is a transcription factor that binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes. ==2. Design Consideration...")
 
(1. Function)
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
 
==1. Function==
 
==1. Function==
This is a transcription factor that binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes.  
+
This is a transcription factor that binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes.
  
 
==2. Design Consideration==
 
==2. Design Consideration==
Line 39: Line 39:
 
==4. References==
 
==4. References==
 
1. https://www.nature.com/articles/s41598-021-82202-7
 
1. https://www.nature.com/articles/s41598-021-82202-7
 +
 +
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K3844003 SequenceAndFeatures</partinfo>

Latest revision as of 03:44, 22 October 2021

1. Function

This is a transcription factor that binds to the Styrene VOC. It mainly regulates and represses the transcription of certain genes.

2. Design Consideration

Our project requires for the transcription factor to be dependent on the presence of VOCs. When researching the design of trimethylbenzene, the VOC that this transcription factor binds to, we needed to make sure that, hypothetically, everything would work based on our model. After checking through extensive research that our design would fit with this transcription factor, we chose it.

3. Chracterization

atggaagtgaacgcgggcggcgtgattgcgtatattagcagcagcagcagcgcgagcagc ccggcgagctgccatagcgaaggcagcgaaaacagctttcagagcagcagcagcagcgtg ccgagcagcccgaacagcagcaacagcgataccaacggcaacccgaaaaacggcgatctg gcgaacattgaaggcattctgaaaaacgatcgcattgattgcagcatgaaaaccagcaaa agcagcgcgccgggcatgaccaaaagccatagcggcgtgaccaaatttagcggcatggtg ctgctgtgcaaagtgtgcggcgatgtggcgagcggctttcattatggcgtgcatgcgtgc gaaggctgcaaaggcttttttcgccgcagcattcagcagaacattcagtataaaaaatgc ctgaaaaacgaaaactgcagcattatgcgcatgaaccgcaaccgctgccagcagtgccgc tttaaaaaatgcctgagcgtgggcatgagccgcgatgcggtgcgctttggccgcattccg aaacgcgaaaaacagcgcatgctgattgaaatgcagagcgcgatgaaaaccatgatgaac agccagtttagcggccatctgcagaacgataccctggtggaacatcatgaacagaccgcg ctgccggcgcaggaacagctgcgcccgaaaccgcagctggaacaggaaaacattaaaagc agcagcccgccgagcagcgattttgcgaaagaagaagtgattggcatggtgacccgcgcg cataaagatacctttatgtataaccaggaacagcaggaaaacagcgcggaaagcatgcag ccgcagcgcggcgaacgcattccgaaaaacatggaacagtataacctgaaccatgatcat tgcggcaacggcctgagcagccattttccgtgcagcgaaagccagcagcatctgaacggc cagtttaaaggccgcaacattatgcattatccgaacggccatgcgatttgcattgcgaac ggccattgcatgaactttagcaacgcgtatacccagcgcgtgtgcgatcgcgtgccgatt gatggctttagccagaacgaaaacaaaaacagctatctgtgcaacaccggcggccgcatg catctggtgtgcccgctgagcaaaagcccgtatgtggatccgcataaaagcggccatgaa atttgggaagaatttagcatgagctttaccccggcggtgaaagaagtggtggaatttgcg aaacgcattccgggctttcgcgatctgagccagcatgatcaggtgaacctgctgaaagcg ggcacctttgaagtgctgatggtgcgctttgcgagcctgtttgatgcgaaagaacgcacc gtgacctttctgagcggcaaaaaatatagcgtggatgatctgcatagcatgggcgcgggc gatctgctgaacagcatgtttgaatttagcgaaaaactgaacgcgctgcagctgagcgat gaagaaatgagcctgtttaccgcggtggtgctggtgagcgcggatcgcagcggcattgaa aacgtgaacagcgtggaagcgctgcaggaaaccctgattcgcgcgctgcgcaccctgatt atgaaaaaccatccgaacgaagcgagcatttttaccaaactgctgctgaaactgccggat Ctgcgcagcctgaacaacatgcatagcgaagaactgctggcgtttaaagtgcatccg


4. References

1. https://www.nature.com/articles/s41598-021-82202-7

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 435
    Illegal PstI site found at 619
    Illegal PstI site found at 1486
    Illegal PstI site found at 1582
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 435
    Illegal PstI site found at 619
    Illegal PstI site found at 1486
    Illegal PstI site found at 1582
    Illegal NotI site found at 1130
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 1176
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 435
    Illegal PstI site found at 619
    Illegal PstI site found at 1486
    Illegal PstI site found at 1582
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 435
    Illegal PstI site found at 619
    Illegal PstI site found at 1486
    Illegal PstI site found at 1582
    Illegal NgoMIV site found at 663
  • 1000
    COMPATIBLE WITH RFC[1000]