Difference between revisions of "Part:BBa K4016025"

(Result)
 
(5 intermediate revisions by one other user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K4016025 short</partinfo>
 
<partinfo>BBa_K4016025 short</partinfo>
  
This composite part is designed to target GFP with [[Part:BBa_K4016026]] through DocS-Coh2 interaction and GFP-GFPnano. With this composite part, aslove2 and Trim21 can be expressed in cells, and HA Tag was added to N-terminal of Trim21, making it easier for Trim21 to be detected by Western Blotting.
+
This composite part is designed to target GFP with [[Part:BBa_K4016026]] through DocS-Coh2 interaction and GFP-GFPnano. With this composite part, aslov2 and Trim21 can be expressed in cells, and HA Tag was added to N-terminal of Trim21, making it easier for Trim21 to be detected by Western Blotting.
  
  
 
==Usage and Biology==
 
==Usage and Biology==
In order to realize the assembly of the light control module, our team connected one basic part in light control module, aslov2, with Trim21, using the separation of aslov2-zdk under blue light and the combination in the dark, thereby indirectly through GFP fluorescence brightness to verify whether aslov2-zdk works.
+
In order to realize the assembly of the light control module, our team connected one basic part in light control module, aslov2, with Trim21, using the separation of aslov2-zdk1 under blue light and the combination in the dark, thereby indirectly through GFP fluorescence brightness to verify whether aslov2-zdk1 works.
  
 
Trim21, an E3 ubiquitin-protein ligase functioning in the intracellular antibody-mediated proteolysis pathway, binds with high affinity to the Fc domain of antibody[1].The ~ 15 kDa aslov2 domain consists of a main body that associates with a host-incorporated flavin cofactor, and a C-terminal Jα helix[2]. Lovtrap is an optogenetic approach for reversible light-induced protein dissociation using protein a fragments that bind to the aslov2 domain only in the dark. Here we describe aslov2 trap and release of protein (LOVTRAP), an optogenetic approach capable of repeatedly and reversibly controlling protein activity with precise kinetics[3].
 
Trim21, an E3 ubiquitin-protein ligase functioning in the intracellular antibody-mediated proteolysis pathway, binds with high affinity to the Fc domain of antibody[1].The ~ 15 kDa aslov2 domain consists of a main body that associates with a host-incorporated flavin cofactor, and a C-terminal Jα helix[2]. Lovtrap is an optogenetic approach for reversible light-induced protein dissociation using protein a fragments that bind to the aslov2 domain only in the dark. Here we describe aslov2 trap and release of protein (LOVTRAP), an optogenetic approach capable of repeatedly and reversibly controlling protein activity with precise kinetics[3].
Line 13: Line 13:
 
This part BBa_K4016025 with [[Part:BBa_K4016026]] demonstrates how our system works. It regulates the target protein (EGFP) degradation under the control of blue light signal. As a functional improvement of the existing Part ([[Part:BBa_K2653016]]), which degrades EGFP constitutively, this new part provides new interface for external signal control.
 
This part BBa_K4016025 with [[Part:BBa_K4016026]] demonstrates how our system works. It regulates the target protein (EGFP) degradation under the control of blue light signal. As a functional improvement of the existing Part ([[Part:BBa_K2653016]]), which degrades EGFP constitutively, this new part provides new interface for external signal control.
  
The PRYSPRY-lgG Fc interaction of [[Part:BBa_K2653016]] is replaced with aslov2-zdk interaction to realize controlling of both initiation and rate of the degradation. Zdk and aslov2 are proteins which separate from each other under induction of blue light. By providing dark environment , aslov2-zdk dimerization would trigger the formation of EGFP-GFPnano-truncated_Trim21 trimer, in which the truncated Trim21 would mediate the ubiquitylation and degradation of EGFP protein.
+
The PRYSPRY-lgG Fc interaction of [[Part:BBa_K2653016]] is replaced with aslov2-zdk1 interaction to realize controlling of both initiation and rate of the degradation. Zdk1 and aslov2 are proteins which separate from each other under induction of blue light. By providing dark environment , aslov2-zdk1 dimerization would trigger the formation of EGFP-GFPnano-truncated_Trim21 trimer, in which the truncated Trim21 would mediate the ubiquitylation and degradation of EGFP protein.
  
 
<html>
 
<html>
Line 28: Line 28:
 
*Here is the mechanism of the recombined HA-Trim21-aslov2:
 
*Here is the mechanism of the recombined HA-Trim21-aslov2:
  
1. zdk-GFPnano dissociate with HA-Trim21-aslov2 by the dissociation of zdk-aslov2 under the light, and in the dark they connect together to work.
+
1. zdk1-GFPnano dissociate with HA-Trim21-aslov2 by the dissociation of zdk1-aslov2 under the light, and in the dark they connect together to work.
  
 
2. GFPnano binds with GFP, and target GFP.
 
2. GFPnano binds with GFP, and target GFP.
Line 63: Line 63:
  
 
==Functional test==
 
==Functional test==
This part (BBa_K4016025) was tested together with zdk-GFPnano ([[Part:BBa_K4016026]]).
+
This part (BBa_K4016025) was tested together with zdk1-GFPnano ([[Part:BBa_K4016026]]).
  
 
===Method===
 
===Method===
*1. Florescent imaging:
+
* Florescent imaging:
To validate the function of our system(Trim21-aslov2-zdk-GFPnano), HEK-293T cells were co-transfected with GFP expressing reporter plasmids and our system expressing plasmids as the experimental group (plasmids: with the parts of Trim21-aslov2 and zdk-GFPnano). HEK-293T cells were co-transfected with GFP expressing reporter plasmids, the cells were divided into two groups. One was provided with blue light for 24 hours and the other was in the dark at the same time(control group). Florescent imaging showed that the different results of GFP fluorescence between cells in dark and under blue lihgt.
+
To validate the function of our system(Trim21-aslov2-zdk1-GFPnano), HEK-293T cells were co-transfected with GFP expressing reporter plasmids and our system expressing plasmids as the experimental group (plasmids: with the parts of Trim21-aslov2 and zdk1-GFPnano). HEK-293T cells were co-transfected with GFP expressing reporter plasmids, the cells were divided into two groups. One was provided with blue light for 24 hours and the other was in the dark at the same time(control group). Florescent imaging showed that the different results of GFP fluorescence between cells in dark and under blue light.
  
 
===Result===
 
===Result===
Line 73: Line 73:
  
  
 +
<html>
 +
 +
<figure class="figure">
 +
<img src="https://2021.igem.org/wiki/images/1/1f/T--NUDT_CHINA--Part_Result_25-26.png
 +
" class="figure-img img-fluid rounded"  height="350px">
 +
 +
</figure>
 +
 +
</html>
 
Figure 2. Fluorescence images and intensity quantification of BBa_K4016025 and BBa_K4016026 transfected group and they were divided into different conditions, in dark and under blue light for 24hours. HEK-293T cells were transfected with GFP-expression plasmid.
 
Figure 2. Fluorescence images and intensity quantification of BBa_K4016025 and BBa_K4016026 transfected group and they were divided into different conditions, in dark and under blue light for 24hours. HEK-293T cells were transfected with GFP-expression plasmid.
 +
 +
 +
  
 
===Reference===
 
===Reference===

Latest revision as of 16:07, 21 October 2021


HA-Trim21-aslov2

This composite part is designed to target GFP with Part:BBa_K4016026 through DocS-Coh2 interaction and GFP-GFPnano. With this composite part, aslov2 and Trim21 can be expressed in cells, and HA Tag was added to N-terminal of Trim21, making it easier for Trim21 to be detected by Western Blotting.


Usage and Biology

In order to realize the assembly of the light control module, our team connected one basic part in light control module, aslov2, with Trim21, using the separation of aslov2-zdk1 under blue light and the combination in the dark, thereby indirectly through GFP fluorescence brightness to verify whether aslov2-zdk1 works.

Trim21, an E3 ubiquitin-protein ligase functioning in the intracellular antibody-mediated proteolysis pathway, binds with high affinity to the Fc domain of antibody[1].The ~ 15 kDa aslov2 domain consists of a main body that associates with a host-incorporated flavin cofactor, and a C-terminal Jα helix[2]. Lovtrap is an optogenetic approach for reversible light-induced protein dissociation using protein a fragments that bind to the aslov2 domain only in the dark. Here we describe aslov2 trap and release of protein (LOVTRAP), an optogenetic approach capable of repeatedly and reversibly controlling protein activity with precise kinetics[3].

This part BBa_K4016025 with Part:BBa_K4016026 demonstrates how our system works. It regulates the target protein (EGFP) degradation under the control of blue light signal. As a functional improvement of the existing Part (Part:BBa_K2653016), which degrades EGFP constitutively, this new part provides new interface for external signal control.

The PRYSPRY-lgG Fc interaction of Part:BBa_K2653016 is replaced with aslov2-zdk1 interaction to realize controlling of both initiation and rate of the degradation. Zdk1 and aslov2 are proteins which separate from each other under induction of blue light. By providing dark environment , aslov2-zdk1 dimerization would trigger the formation of EGFP-GFPnano-truncated_Trim21 trimer, in which the truncated Trim21 would mediate the ubiquitylation and degradation of EGFP protein.

Figure1. Schematic figure of BBa_K4016025 and BBa_K4016026

  • Here is the mechanism of the recombined HA-Trim21-aslov2:

1. zdk1-GFPnano dissociate with HA-Trim21-aslov2 by the dissociation of zdk1-aslov2 under the light, and in the dark they connect together to work.

2. GFPnano binds with GFP, and target GFP.

Characterization

This part was validated through four ways:PCR, enzyme digestion, sequencing and functional test.

PCR

The PCR is performed with Green Taq Mix by Vazyme.

F-Prime:5’CTAGCGTTTAAACTTAAGCTTGCCACCATGGAGTACCCCTACGACGTGCCCGACTAC 3’

R-Prime:5’TGGATATCTGCAGAATTCTTAttaCAGCTCCTTGGCGGCCTC 3’

The PCR protocol is selected based on the Users Manuel. The Electrophoresis was performed on a 1% Agarose gel.


Enzyme Digestion

After the assembly the plasmid was transferred into the Competent E. coli DH5α). After culturing overnight in LB,we minipreped the plasmid for cutting. The cutting procedure was performed with Hind III EcoR I restriction endonuclease bought. The plasmid was cutted in a 20μL system at 37 ℃ for 2 hours. The Electrophoresis was performed on a 1% Agarose glu.

Sequecing

The plasmid was sequenced correct.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 204
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 161
  • 1000
    COMPATIBLE WITH RFC[1000]


Functional test

This part (BBa_K4016025) was tested together with zdk1-GFPnano (Part:BBa_K4016026).

Method

  • Florescent imaging:

To validate the function of our system(Trim21-aslov2-zdk1-GFPnano), HEK-293T cells were co-transfected with GFP expressing reporter plasmids and our system expressing plasmids as the experimental group (plasmids: with the parts of Trim21-aslov2 and zdk1-GFPnano). HEK-293T cells were co-transfected with GFP expressing reporter plasmids, the cells were divided into two groups. One was provided with blue light for 24 hours and the other was in the dark at the same time(control group). Florescent imaging showed that the different results of GFP fluorescence between cells in dark and under blue light.

Result

Florescent imaging showed that comparing to the control group in which HEK-293T cells were co-transfected with GFP expressing reporter plasmid and our designed plasmid and were put in the dark, GFP fluorescence in blue light group was higher than the control group. This confirms that our system stopped the degradation of GFP under blue light, thus verifying the effectiveness of our design.


Figure 2. Fluorescence images and intensity quantification of BBa_K4016025 and BBa_K4016026 transfected group and they were divided into different conditions, in dark and under blue light for 24hours. HEK-293T cells were transfected with GFP-expression plasmid.



Reference

[1] James LC, Keeble AH, Khan Z, Rhodes DA, Trowsdale J. "Structural basis for PRYSPRY-mediated tripartite motif (TRIM) protein function". Proceedings of the National Academy of Sciences of the United States of America. 104 (15): 6200–5. Bibcode:2007PNAS..104.6200J.(2007)

[2] Joshua A. Hammer,Anna Ruta,Jennifer L. West. Using Tools from Optogenetics to Create Light-Responsive Biomaterials: aslovTRAP-PEG Hydrogels for Dynamic Peptide Immobilization[J]. Annals of Biomedical Engineering,2020,48(prepublish):

[3] Hui Wang,Klaus M. Hahn. aslovTRAP: A Versatile Method to Control Protein Function with Light[J]. Current Protocols in Cell Biology,2016,73(1):