Difference between revisions of "Part:BBa K3799002"

 
(11 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K3799002 short</partinfo>
 
<partinfo>BBa_K3799002 short</partinfo>
  
DNase I is a double-strand specific endonuclease that degrades DNA. Bovine pancreatic deoxyribonuclease I (DNase I) is a DNA minor grove-interacting nuclease, which shows relatively low specificity.Bovine pancreatic deoxyribonuclease I (bpDNase) cleaves double-stranded DNA with no sequence specificity making it suitable for degradation of bacterial biofilm.Deoxyribonuclease I (DNase I) enzymes cleave single or double-stranded DNA and require divalent metal ions to hydrolyze DNA yielding 3΄-hydroxyl and 5΄-phosphorylated products.
+
This part contains the coding sequence of Bovine pancreatic DNaseI. DNase I is a double-strand specific endonuclease that degrades DNA. Bovine pancreatic deoxyribonuclease I (DNase I) is a DNA minor grove-interacting nuclease, which shows relatively low specificity. Bovine pancreatic deoxyribonuclease I (bpDNase) cleaves double-stranded DNA with no sequence specificity making it suitable for degradation of bacterial biofilm. Deoxyribonuclease I (DNase I) enzymes cleave single or double-stranded DNA and require divalent metal ions to hydrolyze DNA yielding 3΄-hydroxyl and 5΄-phosphorylated products.
  
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
===Usage and Biology===
 
DNase I is a double-strand specific endonuclease that degrades DNA. Bovine pancreatic deoxyribonuclease I (DNase I) is a DNA minor grove-interacting nuclease, which shows relatively low specificity.Bovine pancreatic deoxyribonuclease I (bpDNase) cleaves double-stranded DNA with no sequence specificity making it suitable for degradation of bacterial biofilm.Deoxyribonuclease I (DNase I) enzymes cleave single or double-stranded DNA and require divalent metal ions to hydrolyze DNA yielding 3΄-hydroxyl and 5΄-phosphorylated products.
 
  
 
<!-- -->
 
<!-- -->
Line 16: Line 14:
 
===Cloning and expression===
 
===Cloning and expression===
  
The coding sequence for DNaseI was initially found from NCBI and then procured synthetically adding biobrick prefix and suffix from TwistBioscience.Cloning was carried out following Normal biobrick assembly using combination of EcoRI and PstI.Linearized plasmid back bone of PSBIC3 obtained by PCR amplification using Plasmid specific primers and Gene fragment were digested with EcoRI and PstI and further ligated .The resultant plasmid was transformed into Ecoli DH5α.Transformed colonies were identified and further confirmed using colony PCR and insert release check.
+
The coding sequence of Bovine pancreatic DNaseI was obtained from TwistBioscience synthetically by adding the Biobrick prefix and suffix. It was cloned into a linearized PSB1C3 vector following normal biobrick assembly and transformed in Ecoli DH5α. Transformants were screened using colony PCR.
  
Primers used
+
[[Image:BBa_K3799002--cPCR.jpeg | thumb | center | 800 px |Colony PCR result of DnaseI coding sequence.A size of 1161 bp was calculated using Snapgene insilico PCR]]
  
Biobrick Forward- gatggaattcgcggccgcttctag,
+
This part was further expressed in Ecoli BL21 under IPTG inducible promoter of Ecoli(BBa_K3799003).This part was screened by colony PCR and further confirmed.
Biobrick reverse- gatgctgcagcggccgctactagta
+
  
Plasmid backbone forward- gctgcagtccggcaaaaaa,
+
[[Image:IISER_Kolkata--cPCR-DNASE_COMP.jpeg | thumb | center | 800 px |Colony PCR result of DnaseI composite part gave succesful result.A size of 1512 bp was calculated using Snapgene insilico PCR]]
Plasmid backbone reverse- gtgaattccagaaatcatccttagcg
+
  
Sequencing forward- tgccacctgacgtctaagaa,
 
Sequencing reverse- attaccgcctttgagtgagc
 
 
Due to time and space constraints for purification of protein,characterization of DNaseI was carried out using industrially prepared DNaseI from Sigma aldrich(D2025)
 
  
 
===Characterization===
 
===Characterization===
  
We determined the activity of DNaseI on biofilm of Pseudomonas aeruginosa using 96 well plate biofilm assay.We did the assay at two different stages to determine the optimum concentration and time required for maximum degradation rate of bacterial biofilm.
+
Characterization of this part was carried out using industrially prepared DNaseI from sigma Aldrich. Biofilm was developed using standard 96 well plate assay and further treated with DNaseI to determine the degradation caused by varying concentrations and time of incubation to get the optimum concentration and time for treatment.
 +
 
 +
Initially, the bacteria were grown in the presence of DNaseI in growth media to determine how DNaseI affects developing biofilm. Bacterial biofilm was grown in 96 well plates in medium containing DNaseI supplemented at different concentrations ranging from 0-25 µg/ml for 72 hours. Biofilm was quantified by checking absorbance at 595 nm after Crystal violet staining.The biofilm degradation rate was compared by calculating biofilm percentage reduction which is given by
  
[[Image:BBa K3799003--plate.jpeg| thumb | center | 250 px |96 well plate Biofilm assay ]]
+
[[Image:BBa K3799002--equation.jpeg | thumb | center | 800 px |]]
  
  
====Pretreatment of bacterial biofilm with DNaseI====
 
  
Pretreatment was done to determine the optimum concentration of DNaseI  which gives maximum degradation of Pseudomonas biofilm.Bacterial biofilm was grown in 96 well plates in medium containing DNaseI supplemented at different concentration ranging from 0-25 µg/ml for 72 hours.Biofilm was quantified by checking absorbance at 595 nm after Crystal violet staining.Biofilm degradation rate was compared by calculating biofilm percentage reduction which is given by
 
  
 
[[Image:BBa_K3799003--pre.jpeg | thumb | center | 800 px |Biofilm percentage reduction under varying concentration of DNaseI ]]
 
[[Image:BBa_K3799003--pre.jpeg | thumb | center | 800 px |Biofilm percentage reduction under varying concentration of DNaseI ]]
  
It was observed that at a concentration of 10 µg/ml gave maximum BPR.BPR didnt further increase with higher concentrations.This concentration was taken as a standard for further experiments.
+
It was observed that a concentration of 10 µg/ml gave maximum BPR.BPR didn't further increase with higher concentrations. This concentration was taken as a standard for further experiments.
  
====Posttreatment of bacterial biofilm with DNaseI====
 
  
Posttreatment was done to determine the optimum incubation time of DNaseI to get maximum degradation.Bacterial biofilm was grown in 96 well plates for 72 hours to get maximum yield.Following this,bacterial colonies were washed off and the pure biofilm in wells were treated with DNaseI supplemented in media at a concentration of 10 µg/ml.Different wells were incubated for time points ranging from 0-50 min.Biofilm yield per condition was quantified by measuring absorbance at 595 nm after crystal violet treatment.Biofilm percentage reduction was further determined to compare degradation rate at different time point.
+
To determine the optimum time for treatment, Bacterial biofilm was grown in 96 well plates for 72 hours to get maximum yield. Following this, bacterial colonies were washed off and the pure biofilm in wells was treated with DNaseI supplemented in media at a concentration of 10 µg/ml. Different wells were incubated for time points ranging from 0-50 min. Biofilm yield per condition was quantified by measuring absorbance at 595 nm after crystal violet treatment. Biofilm percentage reduction was further determined to compare degradation rates at different time points.
  
 
[[Image:BBa_K3799003--post.jpeg | thumb | center | 800 px |Biofilm percentage reduction by DNaseI for different incubation time ]]
 
[[Image:BBa_K3799003--post.jpeg | thumb | center | 800 px |Biofilm percentage reduction by DNaseI for different incubation time ]]

Latest revision as of 19:31, 21 October 2021


Bovine pancreatic DNase I,serum endonuclease of Bos taurus

This part contains the coding sequence of Bovine pancreatic DNaseI. DNase I is a double-strand specific endonuclease that degrades DNA. Bovine pancreatic deoxyribonuclease I (DNase I) is a DNA minor grove-interacting nuclease, which shows relatively low specificity. Bovine pancreatic deoxyribonuclease I (bpDNase) cleaves double-stranded DNA with no sequence specificity making it suitable for degradation of bacterial biofilm. Deoxyribonuclease I (DNase I) enzymes cleave single or double-stranded DNA and require divalent metal ions to hydrolyze DNA yielding 3΄-hydroxyl and 5΄-phosphorylated products.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Cloning and expression

The coding sequence of Bovine pancreatic DNaseI was obtained from TwistBioscience synthetically by adding the Biobrick prefix and suffix. It was cloned into a linearized PSB1C3 vector following normal biobrick assembly and transformed in Ecoli DH5α. Transformants were screened using colony PCR.

Colony PCR result of DnaseI coding sequence.A size of 1161 bp was calculated using Snapgene insilico PCR

This part was further expressed in Ecoli BL21 under IPTG inducible promoter of Ecoli(BBa_K3799003).This part was screened by colony PCR and further confirmed.

Colony PCR result of DnaseI composite part gave succesful result.A size of 1512 bp was calculated using Snapgene insilico PCR


Characterization

Characterization of this part was carried out using industrially prepared DNaseI from sigma Aldrich. Biofilm was developed using standard 96 well plate assay and further treated with DNaseI to determine the degradation caused by varying concentrations and time of incubation to get the optimum concentration and time for treatment.

Initially, the bacteria were grown in the presence of DNaseI in growth media to determine how DNaseI affects developing biofilm. Bacterial biofilm was grown in 96 well plates in medium containing DNaseI supplemented at different concentrations ranging from 0-25 µg/ml for 72 hours. Biofilm was quantified by checking absorbance at 595 nm after Crystal violet staining.The biofilm degradation rate was compared by calculating biofilm percentage reduction which is given by

BBa K3799002--equation.jpeg



Biofilm percentage reduction under varying concentration of DNaseI

It was observed that a concentration of 10 µg/ml gave maximum BPR.BPR didn't further increase with higher concentrations. This concentration was taken as a standard for further experiments.


To determine the optimum time for treatment, Bacterial biofilm was grown in 96 well plates for 72 hours to get maximum yield. Following this, bacterial colonies were washed off and the pure biofilm in wells was treated with DNaseI supplemented in media at a concentration of 10 µg/ml. Different wells were incubated for time points ranging from 0-50 min. Biofilm yield per condition was quantified by measuring absorbance at 595 nm after crystal violet treatment. Biofilm percentage reduction was further determined to compare degradation rates at different time points.

Biofilm percentage reduction by DNaseI for different incubation time

Wells incubated for 40 min showed maximum biofilm degradation.