Difference between revisions of "Part:BBa K1442039"
AshWinShaRma (Talk | contribs) |
Yufan igem (Talk | contribs) (→References) |
||
| (17 intermediate revisions by 4 users not shown) | |||
| Line 136: | Line 136: | ||
| − | = | + | =Contribution : iGEM21_IISER-Tirupati_India= |
| + | <li> | ||
| + | <b>Group:</b> iGEM21_IISER-Tirupati_India | ||
| + | </li> | ||
| + | <li> | ||
| + | <b>Author:</b> Prameya Garge, Ashwin Sharma | ||
| + | </li> | ||
| + | <li> | ||
| + | <b>Summary:</b> | ||
| + | </li> | ||
| + | <partinfo>BBa_K3889069</partinfo> is a modified version specific to our project's assembly. BsmBI recognition site was removed for Golden Gate compatibility. | ||
| + | =Contribution : iGEM22_CSMU_Taiwan= | ||
| + | <li> | ||
| + | <b>Group:</b> iGEM22_CSMU_Taiwan | ||
| + | </li> | ||
| + | <li> | ||
| + | <b>Author:</b> LIN, ZONG-HAN, HSIAO, WEI-CHENG | ||
| + | </li> | ||
| + | <li> | ||
| + | <b>Summary:</b> | ||
| + | </li> | ||
| + | Considering its size, 2A sequences is a good replacement of IRES and P2A has especially high efficiency. A thing worth paying attention to is that people should design their biobrick carefully before using 2A series peptide, because it will control the expression of the protein they design before or after it. | ||
| − | + | ===References=== | |
| − | + | Kim JH, Lee SR, Li LH, Park HJ, Park JH, Lee KY, Kim MK, Shin BA, Choi SY. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One. 2011;6(4):e18556. doi: 10.1371/journal.pone.0018556. Epub 2011 Apr 29. PMID: 21602908; PMCID: PMC3084703. | |
| − | < | + | |
| + | =Contribution : iGEM22_Technion_Israel= | ||
| + | <li> | ||
| + | <b>Group:</b> iGEM22_Technion_Israel | ||
| + | </li> | ||
| + | <li> | ||
| + | <b>Author:</b> Yasmin Habib | ||
| + | </li> | ||
| + | <li> | ||
| + | <b>Summary:</b> | ||
| + | </li> | ||
| + | Our team added the part [https://parts.igem.org/Part:BBa_K4179005 BBa_K4179005], a P2A sequence optimized for E. coli, while conserving the amino acid sequence. | ||
Latest revision as of 06:46, 10 October 2022
P2A self-cleaving peptide sequence
The self-cleaving 2A peptide (18-22 amino acids) is a virally derived coding region that has been utilised by viruses to self-cleave during translation and is likely to have arisen to overcome traditional IRES sequences due to its much smaller coding length and allows for a smaller viral genome [1].
Of the available 2A coding regions coding for the peptide from various viruses: foot-and-mouth disease virus, equine rhinitis A, Thosea asigna, porcine teschovirus-1. The porcine teschovirus 2A (P2A) had the highest efficiency of cleavage in three mammalian cell lines tested by Kim et al [1]: human, zebrafish and adult mice.
The P2A peptide can be used in a research context to allow multicistronic expression of genes without traditional methods of: multiple promoters, insertion of a splicing signal, insertion of a proteolytic cleavage site (e.g. TEV) and IRESs. Of note, P2A overcomes the limitations of an IRES: it is much smaller and also improves the translational efficiency of IRES-based genes [1]. The use of P2A is therefore useful to allow coexpression of large proteins in plasmids where the size of the insert is limiting and preserves the authenicity of a expressed protein sequence over traditionally cleaved protein in vitro such as TEV protease sites that leave a scar site.
Usage and Biology
The P2A sequence was added to our replicon between the MS2 coat protein and RdRp to separate it after translation from an upstream IRES, the P2A acts to reduce the size of the insert, reducing synthesis costs and complications in transformation and transfection.
Characterization by CPU_CHINA 2019
In order to determine the cleavage efficiency of P2A, 2019 CPU_CHINA iGEM team constructed TLR1(Part:BBa_K2976001), P2A self-cleaving peptide sequence (Part:BBa_K1442039) and TLR2 (Part:BBa_K2976002) together. Then, we integrated them into pcDNA6 vector and transfected the vector into HEK293T cells for co-expression of TLR1 and TLR2. The figure shows that the amount of TLR1 (A, B) and TLR2 (C, D) in the cells separately increased after transfection, which demonstrates that P2A exhibits efficient self-cleavage activity.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Characterization from the iGEM Team Hannover 2020
Both P2A and IRES can be used to form multicistronic vectors but their modes of action differ fundamentally. We have characterized the two parts comparatively and thus provided an important basis for the specific use of both parts. We found that IRES is expected to result in a much lower expression of the downstream protein than the P2A peptide, which guarantees a quasi stoichiometric generation of the linked proteins.
Motivation
The P2A peptide as well as an IRES enables the simultaneous expression of multiple coding regions under the control of one single promoter. Whereas the P2A peptide is a short coding region that is cloned in frame with the respective protein coding sequences and exhibits a peptide bond that is cleaved after translation, the IRES represents a noncoding region that forms a 3D secondary structure on the mRNA level which allows ribosome binding independent of the 5’-cap. But which solution should be used for a specific project? To answer this question, we checked P2A and IRES for expression levels of the upstream and downstream gene. The P2A peptide used in this approach (BBa_K3338003) is not identical with the basic part presented here but highly similar. The P2A peptide used here, lacks three N-terminal amino acids and exhibits an additional silent mutation. The lacking GSG-tripeptide is considered as an optional linker that might improve cleavage efficiency (Szymczak-Workman et al. 2012). Because of that the lacking amino acids are probably negligible.
Results
To compare the efficiency of the P2A peptide and the IRES (BBa_K3338004), we cloned P2A as well as IRES as a connector between EGFP and mCherry. Therefore, we amplified P2A and mCherry from the Addgene plasmid #45350 and IRES from the Addgene plasmid #72893 using primers with 20 bp overhangs suitable for NEBuilder® HiFi DNA Assembly cloning (for primers see table 1). The vector backbone was generated by linearizing the pEGFP-C2 vector with EcoRI and BamHI. The finished constructs were sequentially verified. Vector maps of both plasmids are shown in figure 1.
| Primer name | Sequence |
|---|---|
| P2A_fw | CGAGCTGTACAAGTCCGGCCGGACTCAGATCTCGAGCTCAgctactaacttcagcctgctga |
| P2A_rv | tcctcgcccttgctcaccataggtccagggtt |
| mCherry_fw for P2A | tggaggagaaccctggacctatggtgagcaag |
| mCherry_rv for P2A | TGTGGTATGGCTGATTATGATCAGTTATCTAGATCCGGTGcttgtacagctcgtccatgcc |
| IRES_fw | TACAAGTCCGGCCGGACTCAGATCTCGAGCTCAAGCTTCGCTTAGTAGGcccctctccctcccccccccctaac |
| IRES_rv | tcctcgcccttgctcaccatttatcatcgtgtttttcaaaggaaaaccacg |
| mCherry_fw for IRES | tttgaaaaacacgatgataaatggtgagcaagggcgag |
| mCherry_rv for IRES | TGTGGTATGGCTGATTATGATCAGTTATCTAGATCCGGTGcttgtacagctcgtccatgcc |
Figure 1: Vector maps of EGFP-P2A-mCherry (A) and EGFP-IRES-mCherry (B) under control of the CMV-enhancer/promoter.
To compare the stoichiometry of simultaneous expression of both fluorescent proteins in the case of IRES and P2A, respectively, transfection of HeLa cells with either plasmid was performed by lipofection (ViaFect transfection reagent) or electroporation and fluorescence microscopy was used for subsequent analysis. The fluorescence intensities of mCherry and EGFP can be used to assess the expression of both proteins and are roughly comparable among themselves. The results in figure 2 indicate comparable fluorescence intensities of EGFP and mCherry for P2A. Furthermore, all cells exhibiting EGFP-expression also show mCherry expression. In contrast, in the case of IRES large differences in the fluorescence intensities of the EGFP and the mCherry channel were detected. In fact, the expression of EGFP, whose translation is initiated by the standard process involving the 5’-cap, is much higher than the mCherry expression from the IRES. Additionally, many EGFP positive cells did not show an mCherry signal. It is of note that the absolute EGFP expression is higher in the IRES construct whereas the absolute expression of mCherry is higher in the P2A construct. This might be due to the fact that the bigger protein in the P2A construct is produced with a lower efficiency.
Conclusions
Whether P2A or IRES should be used in a project depends on its goal. P2A is particularly well suited if it is important that both proteins are expressed strongly or comparably. IRES can be used if the expression of the upstream protein is to be indicated by a downstream reporter, since in this case a high expression of the first protein is particularly important.
References
Szymczak-Workman, A. L., Vignali, K. M., & Vignali, D. A. (2012). Design and construction of 2A peptide-linked multicistronic vectors. Cold Spring Harbor protocols, 2012(2), 199–204.
Contribution : iGEM21_IISER-Tirupati_India
BBa_K3889069 is a modified version specific to our project's assembly. BsmBI recognition site was removed for Golden Gate compatibility.
Contribution : iGEM22_CSMU_Taiwan
Considering its size, 2A sequences is a good replacement of IRES and P2A has especially high efficiency. A thing worth paying attention to is that people should design their biobrick carefully before using 2A series peptide, because it will control the expression of the protein they design before or after it.
References
Kim JH, Lee SR, Li LH, Park HJ, Park JH, Lee KY, Kim MK, Shin BA, Choi SY. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One. 2011;6(4):e18556. doi: 10.1371/journal.pone.0018556. Epub 2011 Apr 29. PMID: 21602908; PMCID: PMC3084703.
Contribution : iGEM22_Technion_Israel
Our team added the part BBa_K4179005, a P2A sequence optimized for E. coli, while conserving the amino acid sequence.