Difference between revisions of "Part:BBa K3886022"

Latest revision as of 23:22, 20 October 2021

Trace and Control System

Trace and Control System was used in Hidro Project by NDNF_China 2020.

Characterization

To dynamically monitor and control the engineered bacteria beyond the laboratory, we added DNA barcode system and kill switch to microbial genome through gene editing. The genetic circuits design is shown in the following diagram (Figure 1A & 1B). The genome-integrated Tracing and Control system offers tracking and specific killing of engineered strains in case of emergencies.

Figure 1: (A)The design scheme of Trace and Control System in Hidro; (B) The gel image of the result of genome integration of Trace and Control System into fimA site.

Tracing: Customizable Barcode and CRISPR-Cas12a nucleic acid testing offers the way to efficiently trace engineered bacteria

In the Hidro system, in order to achieve Trace and Control, we have incorporated a DNA barcode into engineered strains, which stores user-defined information to distinguish engineered bacteria from natural bacteria. This barcode can effectively help researchers track possible escaped bacterial individuals and distinct engineered strains or natural ones in an out-of-lab environment.

To design the desired barcode, we used https://earthsciweb.org/js/bio/dna-writer/ online tools to generate a DNA Barcode sequence to store 「NDNFChina2021」in the DNA sequence “CTCTACCTCGCTTCACGTCTGCTCACTCTGGTCCTAACAGCGATAGCGTCT” (Figure 2).

Since the Barcode needs to be subsequently detected by CRISPR-Cas12a based nucleic acids, we added the PAM sequence (TTTA) required for Cas12a at the 3' end of the barcode. So the final sequence is "TTTACTCTACCTCGCTTCACGTCTGCTCACTCTGGTCCTAACAGCGATAGCGTCT".

Figure 2: The code table for translating information into DNA barcode.

After the DNA barcode "NDNFChinaiGEM202" has been integrated into the genome of E. coli. To enable efficient tracking of this barcode, we utilized the highly efficient CRISPR-Cas12a nucleic acid detection system. The steps to achieve this detection have been shown in Figure 3.

Figure 3: Steps in CRISPR-Cas12a-based nucleic acid detection system to track escaped strains from Hidro sytem

Lachnospiraceae bacterium ND2006 Cas12a (LbCas12a), which belongs to the class 2 type V-A CRISPR-Cas system, performed collateral cleavage on non-targeted ssDNAs upon the formation of the Cas12a/crRNA/target DNA ternary complex. Similar to the SHERLOCK based on Cas13, Cas12a is of high sensitivity and specificity and is very convenient in the detection of target DNA barcodes on the bacteria genome. If a target DNA exists in the reaction system, the Cas12a/crRNA binary complex forms a ternary complex with the target DNA, which will then trans-cleave non-targeted ssDNA reporter in the system, illuminating the fluorescence which can be easily read by the plate reader or test strip.

It is reported that the minimum detectable concentration for Cas12a-crRNA was approximately 0.1 nM; However, When combined with PCR, the detectable concentration could be as low as 10 aM. Considering that tracking assays for the Hidro system need to be done outside the lab, we need a DNA amplification method that can be used on site without the need for complex equipment. Recombinase polymerase amplification (RPA) is a good choice.

RPA is a single tube, an isothermal alternative to PCR. Because it is isothermal, RPA can use much simpler equipment than PCR. Operating at room temperature means RPA reactions can in theory be run quickly simply by holding a tube by hand. This makes RPA an excellent candidate for developing low-cost, rapid, point-of-care molecular tests.

Once the Hidro system is performing a task or finishing a task, we can apply the crRNA to perform the detection assay to know whether there are any escape events happening. CRISPR-Cas12a could efficiently detect the strain escaping from Hidro. A band will be shown on a test strip when the CRISPR-Cas12a-crRNA complex detects the barcode on the E. coli genome (Figure 4). For more information about Hidro, please visit: NDNF_China Description.

Figure 4: A band is shown on a test strip when CRISPR-Cas12a-crRNA complex detects the barcode on the E. coli genome.

Control: Kill Switch to eliminate any potential risk of escape

After achieving the tracking of the bacteria, we also set up a kill switch system. This kill switch system can kill the target bacteria efficiently, thus eliminating any potential risk of escape (Figure 5A).

In the design, the main parts of the kill switch are 1. a user-customizable inducible promoter, we chose arabinose promoter as an example here; and 2. a toxin gene - Kid.

The kill switch has successfully been integrated into the E. coli Top10 genome using the CRISPR-Cas9 system, thus maintaining the stability of the suicide genetic circuit (Figure 1B).

Kid kill switch has an escape efficiency lower 10^-3, according to the data shown in Figure 5B. Combined with the previous Hidro system's Intrinsic biocontainment efficiency of more than 10^7, the whole Hidro system's escape frequency has lower than 10^10, which has fully met the NIH requirements. For more information about Hidro, please visit: NDNF_China Proof-Of-Concept.

Figure 5: (A) A user-customizable kill switch could eliminate any potential risk of escape; (B) The viability of E. coli with the Kid kill switch with or withour L-arabinose inducer.