Difference between revisions of "Part:BBa K4016023"
ZhixinFang (Talk | contribs) |
ZhixinFang (Talk | contribs) |
||
(2 intermediate revisions by 2 users not shown) | |||
Line 11: | Line 11: | ||
Our composite part [[Part:BBa_K4016023]] is a testing part reacting with BBa_K4016024. To test the result of the trim21-BcL-XL-LD3 interaction, if this can work, we can make an “OFF switch” in a system mediated by small molecules. | Our composite part [[Part:BBa_K4016023]] is a testing part reacting with BBa_K4016024. To test the result of the trim21-BcL-XL-LD3 interaction, if this can work, we can make an “OFF switch” in a system mediated by small molecules. | ||
− | https:// | + | <html> |
+ | |||
+ | <figure class="figure"> | ||
+ | <img src="https://static.igem.org/mediawiki/parts/3/39/T--NUDT_CHINA--Part_SchematicFigure_23-24_.png" class="figure-img img-fluid rounded" height="350px"> | ||
+ | |||
+ | </figure> | ||
+ | |||
+ | </html> | ||
Figure1. Schematic figure of BBa_K4016023 and BBa_K4016024 | Figure1. Schematic figure of BBa_K4016023 and BBa_K4016024 | ||
Line 46: | Line 53: | ||
<!-- --> | <!-- --> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
===Reference=== | ===Reference=== | ||
[1] Giordano-Attianese, G. et al. A computationally designed chimeric antigen receptor provides a small-molecule safety switch for T-cell therapy. Nat Biotechnol 38, 426–432 (2020). | [1] Giordano-Attianese, G. et al. A computationally designed chimeric antigen receptor provides a small-molecule safety switch for T-cell therapy. Nat Biotechnol 38, 426–432 (2020). |
Latest revision as of 16:42, 21 October 2021
HA-Trim21-LD3
This composite part is made up of Trim21 and LD3 sequence. Trim21 is the fuction module in our design which lead to the ubiquitination and degradation of the target module.The introduction of LD3 makes it possible to combine with BcL-XL, which link to the GFP nanobody, thus lead to GFP degradation.As designed,the part can be used as a small molecules mediated system with GFP reporter.
Usage and Biology
Bcl-XL and LD3 are used in our project as an “OFF system”, based on their disassociation ability in response to A1155463. We replaced the PRYSPRY structure of truncated trim21 with the Bcl-xL and LD3 protein pair, and attached Trim21 to the end of LD3 to achieve specific degradation of the GFP protein.
Our composite part Part:BBa_K4016023 is a testing part reacting with BBa_K4016024. To test the result of the trim21-BcL-XL-LD3 interaction, if this can work, we can make an “OFF switch” in a system mediated by small molecules.
Characterization
This part BBa_K4016023 was cloned in pXQ107 plasmid and transfected into HEK293T cell lines using Invitrogen LipofectamineTM 3000.It was validated through four ways: PCR, Sequence, and functional testing.
PCR
The PCR is performed with Green Taq Mix by Vazyme.
F-Prime:5’CTAGCGTTTAAACTTAAGCTTGCCACCATGGAGTACCCCTACGACGTGCCCGACTAC 3’
R-Prime:5’GTGGTGGTGGTGGTGCtcgaGCCGTTCAGCAGCGCCAGCCTG 3’
The PCR protocol is selected based on the Users Manuel. The Electrophoresis was performed on a 1% Agarose gel.
Enzyme Digestion
After the assembly the plasmid was transferred into the Competent E. coli DH5α). After culturing overnight in LB,we minipreped the plasmid for cutting. The cutting procedure was performed with Hind III EcoR I restriction endonuclease bought. The plasmid was cutted in a 20μL system at 37 ℃ for 2 hours. The Electrophoresis was performed on a 1% Agarose glu.
Sequecing
The plasmid was sequenced correct.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 204
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 161
- 1000COMPATIBLE WITH RFC[1000]
Reference
[1] Giordano-Attianese, G. et al. A computationally designed chimeric antigen receptor provides a small-molecule safety switch for T-cell therapy. Nat Biotechnol 38, 426–432 (2020).