Difference between revisions of "Promoters/Catalog/Metal sensitive"
| Line 1: | Line 1: | ||
This set includes promoters that are sensitive to various metals. The promoters are typically regulated by a receptor protein that binds to the metal ion or complex. There are promoters that are sensitive to iron, lead, and copper. | This set includes promoters that are sensitive to various metals. The promoters are typically regulated by a receptor protein that binds to the metal ion or complex. There are promoters that are sensitive to iron, lead, and copper. | ||
| − | promoter_metal_sensing | + | <parttable>promoter_metal_sensing</parttable> |
| + | |||
| + | <html> | ||
| + | <style> | ||
| + | #assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;} | ||
| + | #assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;} | ||
| + | #assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;} | ||
| + | </style> | ||
| + | </html> | ||
Latest revision as of 17:25, 17 April 2009
This set includes promoters that are sensitive to various metals. The promoters are typically regulated by a receptor protein that binds to the metal ion or complex. There are promoters that are sensitive to iron, lead, and copper.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I721001 | Lead Promoter | . . . gaaaaccttgtcaatgaagagcgatctatg | 94 | 4214 | It's complicated | ||
| BBa_I731004 | FecA promoter | . . . ttctcgttcgactcatagctgaacacaaca | 90 | 814 | Not in stock | ||
| BBa_I760005 | Cu-sensitive promoter | atgacaaaattgtcat | 16 | 12396 | Not in stock | ||
| BBa_I765000 | Fe promoter | . . . accaatgctgggaacggccagggcacctaa | 1044 | 1233 | It's complicated | ||
| BBa_J3902 | PrFe (PI + PII rus operon) | . . . tagatatgcctgaaagcgcataccgctatg | 272 | 1250 | It's complicated | ||
| BBa_K1122069 | Ferric uptake repressor box | tgataatcattatca | 15 | 1508 | Not in stock | ||
| BBa_K1163101 | pAceB promoter region | . . . gttttcggatccatgacgaggagctgcacg | 300 | 2652 | Not in stock | ||
| BBa_K1163107 | Fes promoter region | . . . atggcccggaatggcagcgtctgaatgacg | 298 | 1891 | Not in stock | ||
| BBa_K1163110 | YncE promoter region | . . . aaaaatatcggttcatcaaagggagtcgtc | 300 | 1894 | Not in stock | ||
| BBa_K1342005 | zinTp (Cd2+ sensing promoter) (Fw:Lac promoter(-) ver.) | . . . attacacatcatatacattaactctggagg | 81 | 1962 | In stock | ||
| BBa_K1509001 | A bi-directional promoter affected by SmtB protein | . . . gttattcagatattcaaaggagttgctgtc | 100 | 7742 | In stock | ||
| BBa_K1724000 | Pcada | . . . tgactctgtagttgctacagggtgtgcaat | 31 | 5302 | In stock | ||
| BBa_K174016 | Promoterless ArsR binding site | agtaatcaaaataaattgatttattt | 26 | 1602 | Not in stock | ||
| BBa_K174017 | CadA promoter with CzrA binding site | . . . aagctaagaggaggaactactatggctagc | 171 | 1761 | Not in stock | ||
| BBa_K1980006 | pCopA with divergent expressed CueR | . . . taacctttatcatactagaaagaggagaaa | 574 | 6235 | It's complicated | ||
| BBa_K346002 | PmerT promoter (mercury-responsive) | . . . gtacggaagtaaggttacgctatccaatcc | 57 | 13158 | In stock | ||
| BBa_K346054 | PpbrA promoter | . . . ctagagggtgttaaatcggcaacgcgagaa | 56 | 1461 | It's complicated | ||
| BBa_K540001 | rcn, cobalt-sensitive promoter | . . . atcatgaccgaatttacaactcttcttcag | 426 | 6785 | In stock | ||
| BBa_K896008 | zinTp (Cd2+ sensing promoter) | . . . attacacatcatatacattaactctggagg | 81 | 2350 | In stock |