Difference between revisions of "Part:BBa K3930003"
(3 intermediate revisions by 2 users not shown) | |||
Line 58: | Line 58: | ||
<h2>Characterization</h2> | <h2>Characterization</h2> | ||
<h3>Production of ε-carotene</h3> | <h3>Production of ε-carotene</h3> | ||
− | <p>After verifying the correct integration of our insert by PCR, our engineered LycoYeast strains were placed on YPD plates containing the inducers with the aim to detect color changes due to the conversion of lycopenes ( | + | <p>After verifying the correct integration of our insert by PCR, our engineered LycoYeast strains were placed on YPD plates containing the inducers with the aim to detect color changes due to the conversion of lycopenes (orange) to carotenes (yellow).</p> |
<p>Figure 3 shows the colors of the colonies with or without the inducer, the galactose. The LycoYeast-pVIOLETTE strain plated on a YPD + galactose Petri plate shows a yellow coloration, indicating the conversion of lycopene into ε-carotene.</p> | <p>Figure 3 shows the colors of the colonies with or without the inducer, the galactose. The LycoYeast-pVIOLETTE strain plated on a YPD + galactose Petri plate shows a yellow coloration, indicating the conversion of lycopene into ε-carotene.</p> | ||
<br> | <br> | ||
Line 70: | Line 70: | ||
</div> | </div> | ||
<b>Figure 3: </b> <b>Color change in the modified LycoYeast-pVIOLETTE strain</b> | <b>Figure 3: </b> <b>Color change in the modified LycoYeast-pVIOLETTE strain</b> | ||
− | <p>The modified LycoYeast strains change from | + | <p>The modified LycoYeast strains change from orange (lycopene) to yellow (carotene) upon galactose induction, which was the expected result.</p> |
</div> | </div> | ||
</div> | </div> | ||
Line 94: | Line 94: | ||
<br> | <br> | ||
<h3>Production of α-ionone</h3> | <h3>Production of α-ionone</h3> | ||
− | <p>The α-ionone is very volatile. A common strategy to avoid losing these molecules during the culture is to grow the engineered microorganisms in a culture medium supplemented with an organic phase to trap the molecules of interest.The most common organic solvent used is dodecane for ionones (Chen et al. 2019; López et al. 2020).Figure 5 shows the GC-MS spectrum for the LycoYeast-VIOLETTE strain. A peak can be observed at the same retention time as the α-ionone standard for the induced LycoYeast-VIOLETTE strain. The mass spectra associated with this peak matched with the one obtained with the analytical standard. The α-ionone attribution was further confirmed by the NIST mass spectral library (National Institute of Standards and Technology). The production of α-ionone, the main molecule of the violet | + | <p>The α-ionone is very volatile. A common strategy to avoid losing these molecules during the culture is to grow the engineered microorganisms in a culture medium supplemented with an organic phase to trap the molecules of interest.The most common organic solvent used is dodecane for ionones (Chen et al. 2019; López et al. 2020).Figure 5 shows the GC-MS spectrum for the LycoYeast-VIOLETTE strain. A peak can be observed at the same retention time as the α-ionone standard for the induced LycoYeast-VIOLETTE strain. The mass spectra associated with this peak matched with the one obtained with the analytical standard. The α-ionone attribution was further confirmed by the NIST mass spectral library (National Institute of Standards and Technology). The production of α-ionone, the main molecule of the violet odor, was successfully achieved with this construction.</p> |
<br> | <br> | ||
<div class="center"> | <div class="center"> | ||
Line 105: | Line 105: | ||
</div> | </div> | ||
<b>Figure 5: </b> <b>GC-MS analysis of the dodecane layer of the LycoYeast-pVIOLETTE</b> | <b>Figure 5: </b> <b>GC-MS analysis of the dodecane layer of the LycoYeast-pVIOLETTE</b> | ||
− | <p>α-ionone is produced in vivo by our strain upon galactose induction. On the right are presented the mass spectra mass spectra of the observed peak corresponding to α-ionone.</p> | + | <p>α-ionone is produced in vivo by our strain upon galactose induction. On the right are presented the mass spectra mass spectra of the observed peak corresponding to α-ionone. First panel is the α-ionone standard. Second panel is the LycoYeast WT. Third panel is the LycoYeast-pVIOLETTE non-induced. Forth panel is the LycoYeast-pVIOLETTE induced with galactose.</p> |
</div> | </div> | ||
</div> | </div> |
Latest revision as of 17:02, 17 October 2021
α-ionone induction system and expression in Saccharomyces cerevisiae (pViolette)
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal SpeI site found at 5805
Illegal PstI site found at 5798 - 12INCOMPATIBLE WITH RFC[12]Illegal SpeI site found at 5805
Illegal PstI site found at 5798 - 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1265
Illegal BglII site found at 1795
Illegal BamHI site found at 1379
Illegal BamHI site found at 3518
Illegal BamHI site found at 4370
Illegal XhoI site found at 73 - 23INCOMPATIBLE WITH RFC[23]Illegal SpeI site found at 5805
Illegal PstI site found at 5798 - 25INCOMPATIBLE WITH RFC[25]Illegal SpeI site found at 5805
Illegal PstI site found at 5798
Illegal NgoMIV site found at 5303
Illegal AgeI site found at 606
Illegal AgeI site found at 5021 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 4761
Introduction
The pVIOLETTE part (BBa_K3930003) enables the production of α-ionone from lycopene and is composed of:
- the up (BBa_K3930021) and down (BBa_K3930022) integration sites in the XII-4 locus (Chr XII:830227..831248) of the S. cerevisiae genome (based on the plasmid pCfB3040 from Easyclone Marker free kit (Jessop-Fabre et al.,2016)).
- the LcyE-ofCCD1 fusion (BBa_K3930024) codes for a carotenoid cleavage dioxygenase fused to a lycopene cyclase, which allows the production of α-ionone. The sequences were codon optimized for expression into S. cerevisiae.
- the galactose inducible promoter pGal1 (BBa_K3930023), driving the expression of LcyE-phCCD1.
- the resistance marker NsrR (BBa_K3930025) to select yeast integrants.
Construction
IDT and Twist Bioscience performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with the In-Fusion Takara kit into the pCfB3040 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of a correct resulting clones.
pVIOLETTE insert was then linearized with the pVIOLETTE_pCfB3040_Forward and pVIOLETTE_pCfB3040_Reverse linearization primers pVIOLETTE. Then the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows the electrophoresis gel of colony PCR to verify integrants genotype. The expected size was obtained for clone 2.
Primer used to clone this part in the pCfB3040:
- pVIOLETTE_pCfB3040_Forward : 5' cgcccttattcgactctatag 3'
- pVIOLETTE_pCfB3040_Reverse : 5' cgtacctggatggtcatttc 3'
pVIOLETTE insert integration at locus XII-4 was successful. The integrant strain was named LycoYeast-pVIOLETTE and saved as glycerol stock.
Characterization
Production of ε-carotene
After verifying the correct integration of our insert by PCR, our engineered LycoYeast strains were placed on YPD plates containing the inducers with the aim to detect color changes due to the conversion of lycopenes (orange) to carotenes (yellow).
Figure 3 shows the colors of the colonies with or without the inducer, the galactose. The LycoYeast-pVIOLETTE strain plated on a YPD + galactose Petri plate shows a yellow coloration, indicating the conversion of lycopene into ε-carotene.
The carotenoids contained in the cells were extracted using the method described by López et al. (2020). Yeast cells were lysed in acetone using glass beads and the supernatant obtained after lysis was analyzed by RP-HPLC on a C18 column. In the LycoYeast-pVIOLETTE strains, lycopene is converted into a new product with a higher retention time upon induction (Figure 4). Considering the yellow color of pVIOLETTE strain, as well as the α-ionone production results, this new peak most likely corresponds to ε-carotene, the expected precursor.
Production of α-ionone
The α-ionone is very volatile. A common strategy to avoid losing these molecules during the culture is to grow the engineered microorganisms in a culture medium supplemented with an organic phase to trap the molecules of interest.The most common organic solvent used is dodecane for ionones (Chen et al. 2019; López et al. 2020).Figure 5 shows the GC-MS spectrum for the LycoYeast-VIOLETTE strain. A peak can be observed at the same retention time as the α-ionone standard for the induced LycoYeast-VIOLETTE strain. The mass spectra associated with this peak matched with the one obtained with the analytical standard. The α-ionone attribution was further confirmed by the NIST mass spectral library (National Institute of Standards and Technology). The production of α-ionone, the main molecule of the violet odor, was successfully achieved with this construction.
Conclusion and Perspectives
Our LycoYeast-pVIOLETTE strain effectively degrades degrade lycopene into ε-carotene and further transforms it into α-ionone. The quantification of α-ionone production remains to be determined under optimal conditions.
α-ionone belongs to the terpenes family and may have other uses besides perfumery, notably in medicine. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details.
References
- Chen X, Shukal S, Zhang C. 2019. Integrating Enzyme and Metabolic Engineering Tools for Enhanced α-Ionone Production. J Agric Food Chem. 67(49):13451–13459. doi:10.1021/acs.jafc.9b00860.
- Jessop-Fabre MM, Jakočiūnas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. 2016. EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 11(8):1110–1117. doi:10.1002/biot.201600147.
- López J, Bustos D, Camilo C, Arenas N, Saa PA, Agosin E. 2020. Engineering Saccharomyces cerevisiae for the Overproduction of β-Ionone and Its Precursor β-Carotene. Front Bioeng Biotechnol. 8:578793. doi:10.3389/fbioe.2020.578793.