Difference between revisions of "Part:BBa K3930001"

Latest revision as of 16:07, 16 October 2021

β-ionone induction system and expression in S. cerevisiae (pFRAMBOISE-fused) Sequence and Features

Introduction

The pFRAMBOISE-fused part (BBa_K3930001) enables the production of β-ionone from lycopene and is composed of:

- up (BBa_K3930012) and down (BBa_K3930013) integration sites in the X-3 locus (Chr X: 223616..224744) of the S. cerevisiae genome (based on the plasmid pCfB3032 from Easyclone Marker free kit (Jessop-Fabre et al.,2016)).

- the CrtY-phCCD1 fusion (BBa_K3930016), which allows the production of β-ionone. The sequence was codon optimized for an expression into S. cerevisiae.

- the expression block for rtTA-advanced activator of the promoter TetO7 (BBa_K3930019).

- the doxycycline inducible promoter (BBa_K3930014), driving the expression of the CrtY-phCCD1 enzymatic fusion.

- the resistance marker neoR (BBa_K3930020) to select yeast integrants.

Construction

IDT performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with the In-Fusion Takara kit into the pCfB3032 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of a correct resulting clone.

Figure 1: pFRAMBOISE-fused assembly

pFRAMBOISE-fused restriction profile from clone C was checked by digestion visualised on EtBr stained agarose electrophoresis gel. A theoretical gel is presented on the left (note that a different ladder is presented on the theoretical gel).

pFRAMBOISE-fused insert was then linearized with the pFRAMBOISE_pCfB3032_Forward and pFRAMBOISE_pCfB3032_Reverse linearization primers. Then, the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows the electrophoresis gel of colony PCR to verify integrants genotype. The expected size was obtained for clone B1.

Primer used to clone this part in the pCfB3032:

• pFRAMBOISE_pCfB3032_Forward : 5' acaggcaatactctgcag 3'
• pFRAMBOISE_pCfB3032_Reverse : 5' tctctagaaagtataggaacttcac 3'

Figure 2: Integration of pFRAMBOISE-fused in LycoYeast

pFRAMBOISE-fused integration from clone B1 was checked by PCR visualised on EtBr stained agarose electrophoresis gel. A theoretical gel is presented on the right and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel).

pFRAMBOISE-fused insert integration insertion at locus X-3 was successful. The integrant strain was named LycoYeast-pFRAMBOISE-fused and saved as a glycerol stock.

Characterization

Production of β-carotene

After verifying the correct integration of our construction by PCR, our engineered LycoYeast strain was placed on YPD plates containing the doxycycline inducer with the aim to detect color changes due to the conversion of lycopene (red) to carotene (orange) by CrtY.

Figure 3 shows the colors of the colonies with or without the inducer, the doxycycline. The LycoYeast-pFRAMBOISE-fused strain plated on a YPD with doxycycline shows a yellow coloration, indicating the degradation of lycopene into β-carotene. Moreover, a sweet smell of violet could be detected from the Petri plate.

Figure 3: Color change in the modified LycoYeast strains

LycoYeast-pFRAMBOISE-fused strain changed from red (lycopene) to orange (carotene) upon doxycycline induction, which was the expected result. On the left is the LycoYeast WT, and on the right is the LycoYeast-pFRAMBOISE-fused induced strain.

The carotenoids contained in the cells were extracted using the method described by López et al. (2020). Yeast cells were lysed in acetone using glass beads and the supernatant obtained after lysis was analyzed by RP-HPLC on a C18 column. Figure 4 shows that lycopene is converted into a new product with a higher retention time upon induction. Considering the yellow color of the pFRAMBOISE-fused strain, this new peak most likely corresponds to β-carotene, the expected precursor.

Nevertheless, it does not seem that the TetO7 promoter is negatively regulated, as beta-carotene peak is observed even without induction with doxycycline.

Figure 4: Carotenoid analysis of the engineered strain LycoYeast-pFRAMBOISE-fused

tr= retention time; 3 peaks are observed in a non-modified and a modified but not induced LycoYeast while 4 peaks are present in a LycoYeast-pFRAMBOISE strain

Conclusion and Perspectives

These results show that pFRAMBOISE-fused may produce β-carotene thanks to the enzymatic fusion CrtY-phCCD1, indicating that the CrtY part of the construction is functional. It remains to be verified that this part can produce β-ionone thanks to the phCCD1 part of the fusion, and to quantify the β-ionone under the optimal conditions.

The β-ionone belongs to the terpenes family and may have other uses besides perfumery, notably in medicine. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details.

References

1. Chen X, Shukal S, Zhang C. 2019. Integrating Enzyme and Metabolic Engineering Tools for Enhanced α-Ionone Production. J Agric Food Chem. 67(49):13451–13459. doi:10.1021/acs.jafc.9b00860.
2. Jessop-Fabre MM, Jakočiūnas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. 2016. EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 11(8):1110–1117. doi:10.1002/biot.201600147.
3. López J, Bustos D, Camilo C, Arenas N, Saa PA, Agosin E. 2020. Engineering Saccharomyces cerevisiae for the Overproduction of β-Ionone and Its Precursor β-Carotene. Front Bioeng Biotechnol. 8:578793. doi:10.3389/fbioe.2020.578793.