Difference between revisions of "Part:BBa K4047000"
(→Long Description) |
(→Long Description) |
||
| Line 18: | Line 18: | ||
===Long Description=== | ===Long Description=== | ||
| − | This is the forward primer for transaldolase (BBa_K4047034) used to generate the pGEM-tal plasmid described in part BBa_K4047036. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to wild type Synechococcus elongatus PCC 7942 genome for proper amplification. | + | This is the forward primer for transaldolase (BBa_K4047034) used to generate the pGEM-tal plasmid described in part BBa_K4047036. This pairs with the reverse primer part BBa_K4047001. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to wild type Synechococcus elongatus PCC 7942 genome for proper amplification. |
This was also the forward primer for amplification of transaldolase prior to the assembly of pGEM-tal+fbp (BBa_K4047038). Once again, the overlap sequence allows proper Gibson assembly with the pGEM-tal+fbp backbone. The annealing portion (all caps) allows annealing to the wild type S. elongatus PCC 7942 genome for proper amplification. | This was also the forward primer for amplification of transaldolase prior to the assembly of pGEM-tal+fbp (BBa_K4047038). Once again, the overlap sequence allows proper Gibson assembly with the pGEM-tal+fbp backbone. The annealing portion (all caps) allows annealing to the wild type S. elongatus PCC 7942 genome for proper amplification. | ||
| + | |||
| + | Please note that this primer contains the EcoRI and BamHI restriction enzyme sites, limiting part compatibility. These primers were used in our work, and may be useful to future teams similarly limited to the availability of these common enzymes. | ||
Latest revision as of 02:11, 16 October 2021
primerT/TF_tal- forward
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 20
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 20
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 20
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 20
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 20
- 1000COMPATIBLE WITH RFC[1000]
Long Description
This is the forward primer for transaldolase (BBa_K4047034) used to generate the pGEM-tal plasmid described in part BBa_K4047036. This pairs with the reverse primer part BBa_K4047001. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to wild type Synechococcus elongatus PCC 7942 genome for proper amplification.
This was also the forward primer for amplification of transaldolase prior to the assembly of pGEM-tal+fbp (BBa_K4047038). Once again, the overlap sequence allows proper Gibson assembly with the pGEM-tal+fbp backbone. The annealing portion (all caps) allows annealing to the wild type S. elongatus PCC 7942 genome for proper amplification.
Please note that this primer contains the EcoRI and BamHI restriction enzyme sites, limiting part compatibility. These primers were used in our work, and may be useful to future teams similarly limited to the availability of these common enzymes.