Difference between revisions of "Part:BBa K3905014"

 
 
(2 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K3905014 short</partinfo>
 
<partinfo>BBa_K3905014 short</partinfo>
  
−
Amplification probe required for the isothermal amplification of miRNA using Recombinase polymerase amplification. RPA of the miRNA required the design of the 517-5 Probe 2. Probe 2 binds to the 3' end of the miRNA. After phosphorylation of 517-5 Probe 1, DNA ligase is able to ligate 517-5 Probe 2 to 517-5 Probe 1. Allowing RPA to occur for the formation of DNA.  
+
<h4>This is one of the two probes required for the isothermal amplification of miR-517-5p. </h4>
−
For this to occur, the reverse primer 5' AGTGGAGGGTGGAGGGAGGTGGAGGG 3' is added which binds to this probe.
+
 
 +
 
 +
<h2> How our miRPA works </h2>
 +
 
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="500px" src="https://2021.igem.org/wiki/images/7/73/T--City_of_London_UK--Hardware_miRPA1.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
 +
 
 +
As seen in the diagram above, two DNA probes, one with 5’ phosphorylation, bind to the miRNA, and are ligated together by DNA ligase. Then, primers are added, with DNA polymerase, and complementary strands to the ligated probes are synthesised. Then, RPA can take place: primers, associated with recombinase protein so they can dislodge the strands, replicating them in a similar method to PCR, but as no heat cycles are required to break up the strands, the process can take place isothermally.
 +
 
 +
 
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="600px" src="https://2021.igem.org/wiki/images/9/95/T--City_of_London_UK--GRPA2.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
 +
In order for the miRNA to be detected, we decided to use ‘asymmetric RPA’: an excess of forward primers are added (usually 5x the amount), so an excess of the strand that was originally miRNA form, so there is now ssDNA with the miRNA code in DNA. This can be detected by our toehold switches.
 +
 
 +
 
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="600px" src="https://2021.igem.org/wiki/images/thumb/9/90/T--City_of_London_UK--Hardware_miRPA3.png/974px-T--City_of_London_UK--Hardware_miRPA3.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
 +
 
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="600px" src="https://2021.igem.org/wiki/images/0/04/T--City_of_London_UK--grpa4.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
  
  

Latest revision as of 22:53, 21 October 2021


517-5 Probe 2

This is one of the two probes required for the isothermal amplification of miR-517-5p.


How our miRPA works


As seen in the diagram above, two DNA probes, one with 5’ phosphorylation, bind to the miRNA, and are ligated together by DNA ligase. Then, primers are added, with DNA polymerase, and complementary strands to the ligated probes are synthesised. Then, RPA can take place: primers, associated with recombinase protein so they can dislodge the strands, replicating them in a similar method to PCR, but as no heat cycles are required to break up the strands, the process can take place isothermally.


In order for the miRNA to be detected, we decided to use ‘asymmetric RPA’: an excess of forward primers are added (usually 5x the amount), so an excess of the strand that was originally miRNA form, so there is now ssDNA with the miRNA code in DNA. This can be detected by our toehold switches.




Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]