Difference between revisions of "Part:BBa K3806017"

 
 
(5 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K3806017 short</partinfo>
 
<partinfo>BBa_K3806017 short</partinfo>
  
−
prov
+
The TU Delft iGEM 2021 project <html><a href="https://2021.igem.org/Team:TUDelft"><b>AptaVita</b></a></html> looks at developing a modular, quantitative, and accessible rapid diagnostic test for vitamin deficiencies. In this project, vitamin-specific aptazyme biosensors are engineered through a novel <html><i>in vitro</i></html> evolution method, <html><i>De novo</i></html> Rapid <html><i>In vitro</i></html> Evolution of RNA biosensors (DRIVER) [1]. Range <HTML><a href="https://parts.igem.org/Part:BBa_K3806017" target="_blank"><b>BBa_K3806017</b></a></HTML> - <HTML><a href="https://parts.igem.org/Part:BBa_K3806021" target="_blank"><b>BBa_K3806021</b></a></HTML> [1] is a set of primers designed to assist the DRIVER selection process.
−
 
+
−
<!-- Add more about the biology of this part here
+
−
===Usage and Biology===
+
  
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K3806017 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K3806017 SequenceAndFeatures</partinfo>
 +
 +
 +
 +
==Usage and Biology==
 +
<HTML><h3>DRIVER</h3></html>
 +
Starting with a high-diversity library of potential biosensors, DRIVER makes use of a regeneration strategy within a directed-evolution procedure. This grants the selection of sequences that present a higher level of cleavage in the absence of ligand and a lower level of cleavage in the presence of ligand. During rounds in which the ligand(s) are present (also referred to as uncleavage selection rounds), the uncleaved RNA molecules preserve an unmodified 5’ prefix sequence from the previous round. These sequences are PCR amplified using this prefix and a specific suffix as primers. During rounds in which the target ligand(s) are absent (cleavage rounds), RNA molecules that undergo self-cleavage are regenerated by addition of a different 5’ prefix. Afterwards, these sequences are PCR amplified using the newly added prefix and the specific suffix as primers. By iteratively applying this process, each round selectively enriches the desired subset of sequences from the library. Eventually, RNA sequences whose cleavage is regulated by the target ligand(s) dominate the population.
 +
 +
 +
<HTML><u><b>BBa_K3806017 in DRIVER</b></u></html>
 +
 +
Following the uncleavage step where the DNA library is transcribed to RNA and the aptazymes are stabilized by the binding of the ligand, <HTML><a href="https://parts.igem.org/Part:BBa_K3806017" target="_blank"><b>BBa_K3806017</b></a></HTML> is used in a RT step to create a complementary DNA (cDNA) product. Additionally, <HTML><a href="https://parts.igem.org/Part:BBa_K3806017" target="_blank"><b>BBa_K3806017</b></a></HTML> contains the fixed suffix, called sufix X, and  is used as the reverse primer to amplify the cDNA product in both cleavage and uncleavage selection rounds.
 +
 +
Sequence: 5’ TTTTTATTTTTCTTTTTGCTGTTTCGTCC 3’
 +
 +
 +
==References==
 +
<html>
 +
<style>
 +
ol li {
 +
counter-increment: OrderedList;
 +
list-style: none;
 +
}
 +
ol li :before {
 +
content: "[" counter(OrderedList) "]";
 +
}
 +
</style>
 +
 +
<ol>
 +
 +
<li>
 +
[1]Townshend, B., Xiang, J. S., Manzanarez, G., Hayden, E. J. and Smolke, C. (2021). A multiplexed, automated evolution pipeline enables scalable discovery and characterization of biosensors. Nat Commun, 12, 1437.
 +
</li>
 +
 +
</ol>
 +
</html>
  
  

Latest revision as of 13:53, 21 October 2021


RT primer for uncleaved selection + PCR reverse primer (DRIVER)

The TU Delft iGEM 2021 project AptaVita looks at developing a modular, quantitative, and accessible rapid diagnostic test for vitamin deficiencies. In this project, vitamin-specific aptazyme biosensors are engineered through a novel in vitro evolution method, De novo Rapid In vitro Evolution of RNA biosensors (DRIVER) [1]. Range BBa_K3806017 - BBa_K3806021 [1] is a set of primers designed to assist the DRIVER selection process.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage and Biology

DRIVER

Starting with a high-diversity library of potential biosensors, DRIVER makes use of a regeneration strategy within a directed-evolution procedure. This grants the selection of sequences that present a higher level of cleavage in the absence of ligand and a lower level of cleavage in the presence of ligand. During rounds in which the ligand(s) are present (also referred to as uncleavage selection rounds), the uncleaved RNA molecules preserve an unmodified 5’ prefix sequence from the previous round. These sequences are PCR amplified using this prefix and a specific suffix as primers. During rounds in which the target ligand(s) are absent (cleavage rounds), RNA molecules that undergo self-cleavage are regenerated by addition of a different 5’ prefix. Afterwards, these sequences are PCR amplified using the newly added prefix and the specific suffix as primers. By iteratively applying this process, each round selectively enriches the desired subset of sequences from the library. Eventually, RNA sequences whose cleavage is regulated by the target ligand(s) dominate the population.


BBa_K3806017 in DRIVER

Following the uncleavage step where the DNA library is transcribed to RNA and the aptazymes are stabilized by the binding of the ligand, BBa_K3806017 is used in a RT step to create a complementary DNA (cDNA) product. Additionally, BBa_K3806017 contains the fixed suffix, called sufix X, and is used as the reverse primer to amplify the cDNA product in both cleavage and uncleavage selection rounds.

Sequence: 5’ TTTTTATTTTTCTTTTTGCTGTTTCGTCC 3’


References

  1. [1]Townshend, B., Xiang, J. S., Manzanarez, G., Hayden, E. J. and Smolke, C. (2021). A multiplexed, automated evolution pipeline enables scalable discovery and characterization of biosensors. Nat Commun, 12, 1437.