Difference between revisions of "Promoters/Catalog/Eukaryotic/Repressible"

(New page: 200px <br style="clear:both" />)
 
 
(3 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
[[Image:NegativePromoter.png|right|200px]]
 
[[Image:NegativePromoter.png|right|200px]]
 +
All the promoters on this page are eukaryotic promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.  Note that negatively regulated yeast promoters have their own [[Promoters/Catalog/Yeast/Negative|page]].
 
<br style="clear:both" />
 
<br style="clear:both" />
 +
<parttable>promoter_eukaryote_miscellaneous_negative</parttable>
 +
 +
<html>
 +
<style>
 +
#assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;}
 +
#assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;}
 +
#assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;}
 +
</style>
 +
</html>

Latest revision as of 04:05, 17 May 2009

NegativePromoter.png

All the promoters on this page are eukaryotic promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters. Note that negatively regulated yeast promoters have their own page.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I756015CMV Promoter with lac operator sites . . . ttagtgaaccgtcagatcactagtctgcag6631278Not in stock
BBa_I756016CMV-tet promoter . . . ttagtgaaccgtcagatcactagtctgcag6101250Not in stock
BBa_I756017U6 promoter with tet operators . . . ggaaaggacgaaacaccgactagtctgcag3411250Not in stock
BBa_I756018Lambda Operator in SV-40 intron . . . attgtttgtgtattttagactagtctgcag4111253Not in stock
BBa_I756019Lac Operator in SV-40 intron . . . attgtttgtgtattttagactagtctgcag4441244Not in stock
BBa_I756020Tet Operator in SV-40 intron . . . attgtttgtgtattttagactagtctgcag3911244Not in stock
BBa_I756021CMV promoter with Lambda Operator . . . ttagtgaaccgtcagatcactagtctgcag6301259Not in stock