Difference between revisions of "Promoters/Catalog/B. subtilis/Repressible"
 
(3 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
[[Image:NegativePromoter.png|right|200px]]
 
[[Image:NegativePromoter.png|right|200px]]
−
All the promoters on this page are ''B. subtilis'' promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.
+
The B. subtilis promoters of this section are said negativly regulated promoters, because they can be repressed by the expression of a third party protein. The inhibition can be released by the addition of a molecule, like for the LacI ''E. coli'' promoter.
−
<br style="clear:both" />
+
  
−
==Repressible ''B. subtilis'' &sigma;<sup>A</sup> promoters==
+
In the following biobricks, the proposed promoters are build with the fusion of one or several operons with a &sigma;<sub>A</sub> type contitutive promoter.
−
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>A</sup> RNAP]]. &sigma;<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br>
+
  
−
Insert table
+
<parttable>promoter_subtilis_negative_sigmaA</parttable>
  
−
==Repressible ''B. subtilis'' &sigma;<sup>B</sup> promoters==
+
<br />
−
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' &sigma;<sup>B</sup> RNAP]].  &sigma;<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor.  Use these promoters when you want high promoter activity during stationary phase or during starvation.  <br>
+
  
−
Insert table
+
In the future, we may also find promoters builded with the &sigma;<sub>B</sub> promoter.
 +
 
 +
<parttable>promoter_subtilis_negative_sigmaB</parttable>
 +
 
 +
<html>
 +
<style>
 +
#assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;}
 +
#assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;}
 +
#assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;}
 +
</style>
 +
</html>

Latest revision as of 04:49, 4 November 2011

NegativePromoter.png

The B. subtilis promoters of this section are said negativly regulated promoters, because they can be repressed by the expression of a third party protein. The inhibition can be released by the addition of a molecule, like for the LacI E. coli promoter.

In the following biobricks, the proposed promoters are build with the fusion of one or several operons with a σA type contitutive promoter.


More...
NameDescriptionPromoter SequencePositive
Regulators		Negative
Regulators		LengthDocStatus
BBa_K090501Gram-Positive IPTG-Inducible Promoter . . . tggaattgtgagcggataacaattaagctt1072054It's complicated
BBa_K143014Promoter Xyl for B.subtilis . . . agtttgtttaaacaacaaactaataggtga822112Not in stock
BBa_K143015Promoter hyper-spank for B. subtilis . . . aatgtgtgtaattgtgagcggataacaatt1012527Not in stock


In the future, we may also find promoters builded with the σB promoter.


There are no parts for this table