Difference between revisions of "Part:BBa K3829000"

 
 
(One intermediate revision by the same user not shown)
Line 8: Line 8:
 
| width=50% valign='top' style='border: 1px solid black'|
 
| width=50% valign='top' style='border: 1px solid black'|
 
<partinfo>BBa_K3829000 short</partinfo>
 
<partinfo>BBa_K3829000 short</partinfo>
* The terminator used for protein expression in Candida tropicalis T-GAPDH, with a total of 309b. Its nucleic acid sequence presented below:
+
* The terminator used for protein expression in Candida tropicalis T-GAPDH, with a total of 309bp.
ctatccaacaaactctaggggttgtgctttttgaaaaaaacatataggttttattgaaatagccacaatgtctgttgagaggacatttgatttgttttatattatcgtatatgtaccctggaatatattgcgttttttaacaaaagacaaacaacggtctttagtttttttttcaatcaatcaatgttcgtgatcgtagagagaaggagaaaaaaagagtaaacataaacaaacatctttctttttacaaacgagtacaagcaacagccatgtcacaagatgccatacagtccctacttctaaaccaga
+
T-GAPDH, with a total of 309 bp, was used to terminate the transcription of targeted genes in <i>Candida tropicalis</i>.  
 
+
|}
+
 
+
'''Secondary Structure'''
+
 
+
[[Image:Mfold-K3829000-1.png]]
+
  
 
<hr>
 
<hr>
 
'''Measurement'''
 
'''Measurement'''
 
* [http://openwetware.org/wiki/Cconboy:Terminator_Characterization/Results How these parts were measured]
 
* [http://openwetware.org/wiki/Cconboy:Terminator_Characterization/Results How these parts were measured]

Latest revision as of 06:56, 21 October 2021


Terminator.png

protein expression terminator

  • The terminator used for protein expression in Candida tropicalis T-GAPDH, with a total of 309bp.

T-GAPDH, with a total of 309 bp, was used to terminate the transcription of targeted genes in Candida tropicalis.


Measurement

  • [http://openwetware.org/wiki/Cconboy:Terminator_Characterization/Results How these parts were measured]