Difference between revisions of "Collections/Functional Nucleic Acids/Aptamers"

Latest revision as of 17:28, 16 June 2021

This page is part of the Functional Nucleic Acids Registry. Visit the homepage to learn more.

Aptamers: molecule recognition elements

Aptamers are short nucleic-acid motifs that display recognition and binding properties for specific ligands due to their ability to interact and adopt tertiary-structure conformations (Bunka and Stuckley, 2006), analogous to their protein-based counterparts, antibodies (see Fig. 2). Aptamer sequences, developed and identified in vitro, also see their structures and behaviours designed and modelled in silico offering a systematic approach to develop novel candidates that target ligands of interest. Given the programmability entailed by their sequence-based nature, they are also readily interfaced with other forms of nucleic acid circuitry and architectures, increasing the parameter space of control and applicability that can be exerted over their structure and dynamics. Discovered in the early 1990s (Ellington and Szostak, 1990), these DNA or RNA-based molecules now pose great promise across several fields of science, and due to their sensing potential, have been increasingly adopted and harnessed in the context of synthetic biology.

iGEM, as an engineering-based platform for tackling world-class issues, has also seen the incorporation of aptamers as central components of their proposed synthetic biological systems and devices in an ever-growing fashion. Several examples, with contributions from teams coming as early as 2006, showcase the versatility of aptamers as functional tools for the development of innovative solutions spanning water remediation to in vivo monitoring of protein expression. Importantly, Team Heidelberg in 2015 worked on generating a software pipeline for the design of aptamers via modelling and docking, which enables targeting virtually any ligand of interest. This approach, for instance, generated a candidate with binding affinity for kanamycin, which was later characterised by Team DUT China A in 2019 with UV-Vis spectroscopy and found to indeed display strong interactions with the antibiotic molecule.

Figure 2: DNA and RNA aptamers. a) The Kanamycin DNA aptamer developed by iGEM Heidelberg 2015. This DNA aptamer binds to kanamycin with high affinity. b) The Spinach RNA aptamer, a well known fluorescent RNA aptamer. Upon binding to the aptamer, DFHBI becomes fluorescent and renders the Spinach aptamer as a small and efficient reporter.

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_K1126000	TetR aptamer 12_1R	RNA	Mitsuaki Yoshida	70		. . . accagagaaaagcttgatacgcgaaaggag
BBa_K1126001	TetR aptamer 12_1P	RNA	Kanji Nakagawa	64		. . . cagaccagagaaaagcttgatacaaaggag
BBa_K1126002	TetR aptamer 12_1M	RNA	Kanji Nakagawa	62		. . . cacagaccagagaaaagcttgataaaggag
BBa_K1713020	dBroccoli	Reporter	Zhu qi	92	1	. . . gggctcagatgtcgagtagagtgtgggctc
BBa_K3380150	iSpinach fluorescent RNA aptamer	Reporter	Alexandru Popov	78	-1	. . . agtagagtgtgggctccgtagtcgcgtctc
BBa_K3380151	DIR2s-Apt fluorescent RNA aptamer	Reporter	Alexandru Popov	57	-1	. . . cagctggtgaatgacagctatggcgcatcc
BBa_K4213000	Plant Thiamine Pyrophosphate Riboswitch	Regulatory	Ioannis Retalis	675	-1	. . . tacagccataaaagaagtctttaactcgct
BBa_K734002	Spinach Aptamer with Stabilizing tRNA Scaffold	Reporter	Logan Bachman	145	2	. . . gggttgcaggttcaattcctgtccgtttca
BBa_K738000	RNA Scaffold generator	Generator	Huachun Liu	171		. . . gcctctaaacgggtcttgaggggttttttg
BBa_K738002	Theophyline riboswitch regulated RNA Scaffold (clover vision 2)	Generator	Huachun Liu	217		. . . gcctctaaacgggtcttgaggggttttttg

References

Bunka, D., Stockley, P. (2006). Aptamers come of age – at last. Nature Reviews Microbiology 4, 588–596 . https://doi.org/10.1038/nrmicro1458

Ellington, A. D. & Szostak, J. W. (1990). In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818–822. https://doi.org/10.1038/346818a0

@@ Line 1: / Line 1: @@
+<html><div style="background-color: #CCFFCC; padding: 10px; border: 1px solid green;"> This page is part of the Functional Nucleic Acids Registry. Visit the <a href="https://parts.igem.org/Collections/Functional_Nucleic_Acids">homepage</a> to learn more. </div></html>
 <p style="font-size:20px"><b>Aptamers: molecule recognition elements</b></p>
-<p>Aptamers are short nucleic-acid motifs that display recognition and binding properties for specific ligands due to their ability to interact and adopt tertiary-structure conformations (Bunka and Stuckley, 2006), analogous to their protein-based counterparts, antibodies (see Fig. 2). Aptamer sequences, developed and identified in vitro, also see their structures and behaviours designed and modelled in silico (as discussed in detail in [document already written by Anastasios]) offering a systematic approach to develop novel candidates that target ligands of interest. Given the programmability entailed by their sequence-based nature, they are also readily interfaced with other forms of nucleic acid circuitry and architectures, increasing the parameter space of control and applicability that can be exerted over their structure and dynamics. Discovered in the early 1990s (Ellington and Szostak, 1990), these DNA or RNA-based molecules now pose great promise across several fields of science, and due to their sensing potential, have been increasingly adopted and harnessed in the context of synthetic biology.</p>
+<p style="text-align:justify">Aptamers are short nucleic-acid motifs that display recognition and binding properties for specific ligands due to their ability to interact and adopt tertiary-structure conformations (Bunka and Stuckley, 2006), analogous to their protein-based counterparts, antibodies (see Fig. 2). Aptamer sequences, developed and identified in vitro, also see their structures and behaviours designed and modelled in silico offering a systematic approach to develop novel candidates that target ligands of interest. Given the programmability entailed by their sequence-based nature, they are also readily interfaced with other forms of nucleic acid circuitry and architectures, increasing the parameter space of control and applicability that can be exerted over their structure and dynamics. Discovered in the early 1990s (Ellington and Szostak, 1990), these DNA or RNA-based molecules now pose great promise across several fields of science, and due to their sensing potential, have been increasingly adopted and harnessed in the context of synthetic biology.</p>
-<p> iGEM, as an engineering-based platform for tackling world-class issues, has also seen the incorporation of aptamers as central components of their proposed synthetic biological systems and devices in an ever-growing fashion. Several examples, with contributions from teams coming as early as 2006, showcase the versatility of aptamers as functional tools for the development of innovative solutions spanning water remediation to in vivo monitoring of protein expression.  Importantly, Team Heidelberg in 2015 worked on generating a software pipeline for the design of aptamers via modelling and docking, which enables targeting virtually any ligand of interest. This approach, for instance, generated a candidate with binding affinity for kanamycin, which was later characterised by Team DUT China A in 2019 with UV-Vis spectroscopy and found to indeed display strong interactions with the antibiotic molecule. </p>
+<p style="text-align:justify"> iGEM, as an engineering-based platform for tackling world-class issues, has also seen the incorporation of aptamers as central components of their proposed synthetic biological systems and devices in an ever-growing fashion. Several examples, with contributions from teams coming as early as 2006, showcase the versatility of aptamers as functional tools for the development of innovative solutions spanning water remediation to in vivo monitoring of protein expression.  Importantly, Team Heidelberg in 2015 worked on generating a software pipeline for the design of aptamers via modelling and docking, which enables targeting virtually any ligand of interest. This approach, for instance, generated a candidate with binding affinity for kanamycin, which was later characterised by Team DUT China A in 2019 with UV-Vis spectroscopy and found to indeed display strong interactions with the antibiotic molecule. </p>
 [[File:FNA aptamers.png|500px|center|thumb| <b>Figure 2: DNA and RNA aptamers.</b> <b>a)</b> The Kanamycin DNA aptamer developed by iGEM Heidelberg 2015. This DNA aptamer binds to kanamycin with high affinity. <b>b)</b> The Spinach RNA aptamer, a well known fluorescent RNA aptamer. Upon binding to the aptamer, DFHBI becomes fluorescent and renders the Spinach aptamer as a small and efficient reporter.]]
+<parttable>aptamers_rna</parttable>
+<p style="font-size:14px"><b>References</b></p>
+<p>Bunka, D., Stockley, P. (2006). Aptamers come of age – at last. Nature Reviews Microbiology 4, 588–596 . https://doi.org/10.1038/nrmicro1458 </p>
+<p>Ellington, A. D. & Szostak, J. W. (1990). In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818–822. https://doi.org/10.1038/346818a0 </p>