Latest revision as of 22:56, 16 December 2020

F. psychrophilum LFA control probe (16S rRNA)

Introduction

Vilnius-Lithuania iGEM 2020 project FlavoFlowincludes three goals towards looking for Flavobacterium disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. This part was used for the first goal- detection - of the project FlavoFlow.

Overview

Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacterium identification and detection purposes. F. psychrophilum causes cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.

Detection system

Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.

Bioinformatic analysis

Usually, for phylogenetic analysis and identification 16S rRNA gene can be used¹. For this reason, we developed LFA probes based on this gene sequence. F. psychrophilum 16S rRNA gene (AY662493) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for F. psychrophilum LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).

Figure 1. 1 - Flavobacterium species 16S rRNA partial gene sequences alignment. Black boxes highlight sequence parts chosen for probe placement. Gene sequences: F. columnare - AY577821, F. branchiophilum - AB680752, F. psychrophilum - AY662493.

To develop the F. psychrophilum LFA test based on 16S rRNA gene these parts are needed: BBa_K3416107, BBa_K3416108,BBa_K3416109. Primers to amplify a fragment of 16S rRNA are:

F_Psychro: CCCAGAGAAATTTGGATTAATACCTC

R_Psychro: CAACTAGCTAATGGGACGCA

In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.

Description of 16S F. psychrophilum control probe

BBa_K3416108 is a capture probe that is sprayed on the nitrocellulose membrane with a dispensing system such as BioDot. This sequence must be modified. Our team added a poly-A to make sure that the probe sequence itself is available for hybridization. Also a biotin moiety (bio, IDT) on the 3’ end must be added. Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction.

Sequence and Features

References

1. Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).
2. Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
3. Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).