Difference between revisions of "Part:BBa K3416107"
 
(One intermediate revision by one other user not shown)
Line 4: Line 4:
  
 
=Introduction=
 
=Introduction=
−
[[File:T--Vilnius-Lithuania--FFlogo.png|80px|right|FlavoFlow]]
+
[[File:T--Vilnius-Lithuania--FFlogo.png|100px|right|FlavoFlow]]
  
 
Vilnius-Lithuania iGEM 2020 project [https://2020.igem.org/Team:Vilnius-Lithuania <b>FlavoFlow</b>]includes three goals towards looking for <i>Flavobacterium</i> disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines.
 
Vilnius-Lithuania iGEM 2020 project [https://2020.igem.org/Team:Vilnius-Lithuania <b>FlavoFlow</b>]includes three goals towards looking for <i>Flavobacterium</i> disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines.
 
This part was used for the first goal- detection - of the project FlavoFlow.
 
This part was used for the first goal- detection - of the project FlavoFlow.
−
 
+
__TOC__
 
==Overview==
 
==Overview==
 
Vilnius Lithuania iGEM 2020 team decided to create a <b>lateral flow assay (LFA)</b> test for <i>Flavobacterium</i> identification and detection purposes. <i>F. psychrophilum</i> causes cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a <b>helicase dependent amplification (HDA)-LFA</b> based detection test that in a few hours can identify an exact bacteria.  
 
Vilnius Lithuania iGEM 2020 team decided to create a <b>lateral flow assay (LFA)</b> test for <i>Flavobacterium</i> identification and detection purposes. <i>F. psychrophilum</i> causes cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a <b>helicase dependent amplification (HDA)-LFA</b> based detection test that in a few hours can identify an exact bacteria.  
Line 17: Line 17:
  
 
===Bioinformatic analysis===
 
===Bioinformatic analysis===
−
Usually, for phylogenetic analysis and identification 16S rRNA gene can be used<sup>1</sup>. For this reason, we developed LFA probes based on this gene sequence. <i>F. columnare</i> <b>16S rRNA gene</b> (AY662493) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for <i>F. psychrophilum</i> LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).  
+
Usually, for phylogenetic analysis and identification 16S rRNA gene can be used<ref>Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. <i>Journal of Clinical Microbiology</i>, <b>45</b>, 2761–2764 (2007).</ref>. For this reason, we developed LFA probes based on this gene sequence. <i>F. psychrophilum</i> <b>16S rRNA gene</b> (AY662493) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for <i>F. psychrophilum</i> LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).  
  
  
Line 33: Line 33:
  
 
In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in [https://2020.igem.org/Team:Vilnius-Lithuania/Experiments Vilnius-Lithuania iGEM 2020 team wiki page.]
 
In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in [https://2020.igem.org/Team:Vilnius-Lithuania/Experiments Vilnius-Lithuania iGEM 2020 team wiki page.]
−
 
  
 
===Description of 16S <i>F. psychrophilum</i> detection probe===
 
===Description of 16S <i>F. psychrophilum</i> detection probe===
−
<b>BBa_K3416107</b> is a detection probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without <b>thiol group</b> modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle<sup>2</sup>. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the <b>5’ end</b>. Also, the probe should contain a <b>poly-A</b> sequence for efficient gold nanoparticles functionalization using a low pH method<sup>3</sup>. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.
+
<b>BBa_K3416107</b> is a detection probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without <b>thiol group</b> modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle<ref>Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. <i>Anal. Methods</i>, <b>9</b>, 2633–2643 (2017).</ref>. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the <b>5’ end</b>. Also, the probe should contain a <b>poly-A</b> sequence for efficient gold nanoparticles functionalization using a low pH method<ref>Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. <i>J. Am. Chem. Soc.</i>, <b>134</b>, 7266–7269 (2012).</ref>. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.
  
  
Line 47: Line 46:
 
|}
 
|}
  
 +
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K3416107 SequenceAndFeatures</partinfo>
 +
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K3416107 parameters</partinfo>
 +
<!-- -->
 +
 +
=References=
  
−
===References===
+
<references />
−
#  Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. <i>Journal of Clinical Microbiology</i>, <b>45</b>, 2761–2764 (2007).
+
−
#  Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. <i>Anal. Methods</i>, <b>9</b>, 2633–2643 (2017).
+
−
#  Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. <i>J. Am. Chem. Soc.</i>, <b>134</b>, 7266–7269 (2012).
+

Latest revision as of 22:54, 16 December 2020


F. psychrophilum LFA detection probe (16S rRNA)

Introduction

FlavoFlow

Vilnius-Lithuania iGEM 2020 project FlavoFlowincludes three goals towards looking for Flavobacterium disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. This part was used for the first goal- detection - of the project FlavoFlow.

Overview

Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacterium identification and detection purposes. F. psychrophilum causes cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.

Detection system

Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.


Bioinformatic analysis

Usually, for phylogenetic analysis and identification 16S rRNA gene can be used[1]. For this reason, we developed LFA probes based on this gene sequence. F. psychrophilum 16S rRNA gene (AY662493) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for F. psychrophilum LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).


Figure 1. 1 - Flavobacterium species 16S rRNA partial gene sequences alignment. Black boxes highlight sequence parts chosen for probe placement. Gene sequences: F. columnare - AY577821, F. branchiophilum - AB680752, F. psychrophilum - AY662493.


To develop the F. psychrophilum LFA test based on 16S rRNA gene these parts are needed: BBa_K3416107, BBa_K3416108,BBa_K3416109. Primers to amplify a fragment of 16S rRNA are:


F_Psychro: CCCAGAGAAATTTGGATTAATACCTC

R_Psychro: CAACTAGCTAATGGGACGCA

In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.

Description of 16S F. psychrophilum detection probe

BBa_K3416107 is a detection probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without thiol group modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle[2]. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the 5’ end. Also, the probe should contain a poly-A sequence for efficient gold nanoparticles functionalization using a low pH method[3]. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.


Table 1. | Parameters of detection probe created for nucleic acid lateral flow assay test.
Species Probe type Sequence and its modification Hybridization site
F. psychrophilum 16S rRNA gene(AY662493) Detection probe ThioMC6-D-(A)20-AGT GAG TTG 148-156 bp

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


References

  1. ↑ Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).
  2. ↑ Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
  3. ↑ Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).