Difference between revisions of "Collections/iGEM Type IIS Collections"

m
(Team Uppsala 2020's iGEM Type IIS Standard collection)
 
(5 intermediate revisions by the same user not shown)
Line 6: Line 6:
 
Until very recently, the main assembly standard supported by the iGEM registry was the BioBrick standard RFC[10]. However, iGEM Type IIS RFC[1000] assembly was recently accepted as a <html><a href=”https://parts.igem.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards”>registry standard</a></html>, and multiple Type IIS backbones and parts were present in the <html><a href=”https://parts.igem.org/Help:2019_DNA_Distribution”>2019 DNA distribution kit</a></html>. We strongly believe in the efficiency and power of this cloning method since it can assemble multiple parts in one reaction, and we wanted to contribute to the development of this standard so that it can be used comfortably by the iGEM community.
 
Until very recently, the main assembly standard supported by the iGEM registry was the BioBrick standard RFC[10]. However, iGEM Type IIS RFC[1000] assembly was recently accepted as a <html><a href=”https://parts.igem.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards”>registry standard</a></html>, and multiple Type IIS backbones and parts were present in the <html><a href=”https://parts.igem.org/Help:2019_DNA_Distribution”>2019 DNA distribution kit</a></html>. We strongly believe in the efficiency and power of this cloning method since it can assemble multiple parts in one reaction, and we wanted to contribute to the development of this standard so that it can be used comfortably by the iGEM community.
  
Our parts collection provides three (four?) types of Type IIS parts. Firstly, it includes the new backbones detailed in the previous section as well as an improved version of pEven Level 2 backbones. Then, it includes dummy parts which can be used as placeholders when your planned assembly has less than four parts, the amount needed for iGEM Type IIS reactions. Finally (Afterwards?), it includes template parts which have no biological function, but are instead easy to use blueprints to design parts for this assembly method. (Finally, it includes some general use (parts, such as) RBS, which are tailored specifically for iGEM Type IIS assembly).
+
Our parts collection provides four types of Type IIS parts.  
 +
<html>
 +
<ul>
 +
<li> New backbones: Improved version of pEven Level 2 backbones, along with new pOdd backbones of medium (10-12) and low (~5) copy number for Level 3 assemblies. </li>
 +
<li> Templates: Parts which have no biological function, but are instead easy to use blueprints to design Type IIS-compatible parts.</li>
 +
<li> Dummy parts: Placeholders when your planned assembly has less than four parts, the amount needed for iGEM Type IIS reactions.</li>
 +
<li> RBS: commonly used RBS from the registry which are tailored specifically for iGEM Type IIS assembly. </li>
 +
</ul>
 +
</html>
 +
 
 +
Additionally to this part collection, we compiled all our design and experimental experiences in an iGEM Type IIS standard guidebook. Check it out <html><a href="https://2020.igem.org/wiki/images/e/e2/T--UofUppsala--typeIIS_guide_new.pdf">here!</a></html>.
  
 
Sequencing files of all the parts can be downloaded <html><a href="https://2020.igem.org/wiki/images/f/f2/T--UofUppsala--TypeIIS_sequencing.zip">here</a></html>.
 
Sequencing files of all the parts can be downloaded <html><a href="https://2020.igem.org/wiki/images/f/f2/T--UofUppsala--TypeIIS_sequencing.zip">here</a></html>.
Line 13: Line 23:
 
<parttable>collection_typeiis_uppsala_plasmidbackbones</parttable>
 
<parttable>collection_typeiis_uppsala_plasmidbackbones</parttable>
  
To include a part in this table, include the categories "//collections/typeiis/uppsala" and set the part type to Plasmid_Backbone under the Hard Information tab of the part.
+
===Templates===
 
+
<parttable>collection_typeiis_uppsala_templates</parttable>
  
 
===Dummy parts===
 
===Dummy parts===
 
<parttable>collection_typeiis_uppsala_placeholders</parttable>
 
<parttable>collection_typeiis_uppsala_placeholders</parttable>
 
 
===Templates===
 
<parttable>collection_typeiis_uppsala_templates</parttable>
 
 
  
 
===RBS===
 
===RBS===
 
<parttable>collection_typeiis_uppsala_rbs</parttable>
 
<parttable>collection_typeiis_uppsala_rbs</parttable>
 
To include a part in this table, include the categories "//collections/typeiis/uppsala" and set the part type to RBS under the Hard Information tab of the part.
 

Latest revision as of 17:22, 16 December 2020

Team Uppsala 2020's iGEM Type IIS Standard collection

Until very recently, the main assembly standard supported by the iGEM registry was the BioBrick standard RFC[10]. However, iGEM Type IIS RFC[1000] assembly was recently accepted as a registry standard, and multiple Type IIS backbones and parts were present in the 2019 DNA distribution kit. We strongly believe in the efficiency and power of this cloning method since it can assemble multiple parts in one reaction, and we wanted to contribute to the development of this standard so that it can be used comfortably by the iGEM community.

Our parts collection provides four types of Type IIS parts.

  • New backbones: Improved version of pEven Level 2 backbones, along with new pOdd backbones of medium (10-12) and low (~5) copy number for Level 3 assemblies.
  • Templates: Parts which have no biological function, but are instead easy to use blueprints to design Type IIS-compatible parts.
  • Dummy parts: Placeholders when your planned assembly has less than four parts, the amount needed for iGEM Type IIS reactions.
  • RBS: commonly used RBS from the registry which are tailored specifically for iGEM Type IIS assembly.

Additionally to this part collection, we compiled all our design and experimental experiences in an iGEM Type IIS standard guidebook. Check it out here!.

Sequencing files of all the parts can be downloaded here.

Plasmid Backbones


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K3425001pSB3C11: Improved pEven1 Loop Vector based on pSB3C01 Plasmid_BackboneNria Garriga Alonso2729-1 . . . cccttagtgactcgaattcggtctcaggag
BBa_K3425002 pSB3C12: Improved pEven2 Loop Vector based on pSB3C02Plasmid_BackboneNria Garriga Alonso2729-1 . . . cccttagtgactcgaattcggtctcatact
BBa_K3425003 pSB3C13: Improved pEven3 Loop Vector based on pSB3C03Plasmid_BackboneNria Garriga Alonso2729-1 . . . cccttagtgactcgaattcggtctcaaatg
BBa_K3425004pSB3C14: Improved pEven4 Loop Vector based on pSB3C04Plasmid_BackboneNria Garriga Alonso2729-1 . . . cccttagtgactcgaattcggtctcagctt
BBa_K3425005pSB3K01: pOdd1 Loop Vector based on pSB3K3Plasmid_BackboneNria Garriga Alonso2739-1 . . . aggatgatttctggaattcgctcttcaatg
BBa_K3425006pSB3K02: pOdd2 Loop Vector based on pSB3K3Plasmid_BackboneNria Garriga Alonso2739-1 . . . aggatgatttctggaattcgctcttcagca
BBa_K3425008pSB3K04: pOdd4 Loop Vector based on pSB3K3Plasmid_BackboneNria Garriga Alonso2739-1 . . . aggatgatttctggaattcgctcttcacag
BBa_K3425009pSB4K01: pOdd1 Loop Vector based on pSB4K5Plasmid_BackboneNria Garriga Alonso3444-1 . . . aggatgatttctggaattcgctcttcaatg
BBa_K3425010pSB4K02: pOdd2 Loop Vector based on pSB4K5Plasmid_BackboneNria Garriga Alonso3444-1 . . . aggatgatttctggaattcgctcttcagca
BBa_K3425011pSB4K03: pOdd3 Loop Vector based on pSB4K5Plasmid_BackboneNria Garriga Alonso3444-1 . . . aggatgatttctggaattcgctcttcatac
BBa_K3425012pSB4K04: pOdd4 Loop Vector based on pSB4K5Plasmid_BackboneNria Garriga Alonso3444-1 . . . aggatgatttctggaattcgctcttcacag
BBa_K3425013pSB4A01: pOdd1 Loop Vector based on pSB4A5Plasmid_BackboneNria Garriga Alonso3420-1 . . . aggatgatttctggaattcgctcttcaatg
BBa_K3425014pSB4A02: pOdd2 Loop Vector based on pSB4A5Plasmid_BackboneNria Garriga Alonso3420-1 . . . aggatgatttctggaattcgctcttcagca
BBa_K3425015pSB4A03: pOdd3 Loop Vector based on pSB4A5Plasmid_BackboneNria Garriga Alonso3420-1 . . . aggatgatttctggaattcgctcttcatac
BBa_K3425016pSB4A04: pOdd4 Loop Vector based on pSB4A5Plasmid_BackboneNria Garriga Alonso3420-1 . . . aggatgatttctggaattcgctcttcacag

Templates


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K3425017iGEM Type IIS standard promoter templateOtherNria Garriga Alonso, Bjrn Ancker Persson, Tereza Hubackova, Dorottya Marko, Hui Yu49-1 . . . aaaaaaaaaatactcgagagaagagcgtaa
BBa_K3425018 iGEM Type IIS standard RBS template OtherNria Garriga Alonso, Bjrn Ancker Persson, Tereza Hubčkov, Dorottya Marko, Hui Yu49-1 . . . ggggggggggaatgcgagagaagagcgtaa
BBa_K3425019iGEM Type IIS standard CDS templateOtherNria Garriga Alonso, Bjrn Ancker Persson, Tereza Hubčkov, Dorottya Marko, Hui Yu49-1 . . . aaaaaaaaaagcttcgagagaagagcgtaa
BBa_K3425020iGEM Type IIS standard terminator templateOtherNria Garriga Alonso, Bjrn Ancker Persson, Tereza Hubčkov, Dorottya Marko, Hui Yu49-1 . . . aaaaaaaaaacgctcgagagaagagcgtaa

Dummy parts


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K3425021iGEM Type IIS standard Level 1 Dummy (TU-DY)OtherNuria Garriga Alonso, Bjorn Ancker Persson, Tereza Hubackova, Dorottya Marko, Hui Yu12-1ggagaacacgct
BBa_K3425022iGEM Type IIS standard Level 2 Dummy (MTU-DY)OtherNuria Garriga Alonso, Bjorn Ancker Persson, Tereza Hubackova, Dorottya Marko, Hui Yu12-1aatgaacaggta
BBa_K3425023iGEM Type IIS pSB1K01-DY OtherNria Garriga Alonso16-1ggaggctcgtatcgct
BBa_K3425024iGEM Type IIS pSB1K02-DY OtherNria Garriga Alonso16-1ggaggatagtgccgct
BBa_K3425025iGEM Type IIS pSB1K03-DY OtherNria Garriga Alonso16-1ggagagccgctgcgct
BBa_K3425026iGEM Type IIS pSB1K04-DY OtherNria Garriga Alonso16-1ggaggtgatcaccgct
BBa_K3425027iGEM Type IIS pSB3C11-DY OtherNria Garriga Alonso16-1aatgaactacggggta
BBa_K3425028iGEM Type IIS pSB3C12-DY OtherNria Garriga Alonso16-1aatgagctgcgtggta
BBa_K3425029iGEM Type IIS pSB3C13-DY OtherNria Garriga Alonso16-1aatgagtgtagtggta
BBa_K3425030iGEM Type IIS pSB3C14-DY OtherNria Garriga Alonso16-1aatgcaccgatcggta

RBS


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K3425031RBS for Type IIS iGEM Standard AssemblyRBSTereza Hubackova18-1tcacacaggaaagtacta
BBa_K3425032RBS for Type IIS iGEM Standard AssemblyRBSTereza Hubackova17-1aaagaggagaaatagta
BBa_K3425033RBS for Type IIS iGEM Standard AssemblyRBSTereza Hubackova20-1attaaagaggagaaatagta