Difference between revisions of "Part:BBa K3570006"

Latest revision as of 12:10, 26 October 2020

DPP1 upstream homologous sequence

Usage

DPP1 upstream homology arm part shall be used together with DPP1 downstream homology arm part (BBa_K3570007) to target a functional yeast integration locus. When DPP1 up put to 5' of the biobrick together with DPP1 downstream to the 3', the biobrick can be integrated into the S. cerevisiae's genome. It will target an homologous recombination within the Diacylglycerol pyrophosphate phosphatase 1 (DPP1) gene.

This sequence was identified from a personal communication with Dr. Gilles Truan.

Experiments

We used this part in the insertion of the tHMG1 and CrtE genes (part BBa_K3570000) in the yeast genome. Below is our yeast transformation protocol and our results which show that we have successfully integrated this part and that BBa_K3570006 and BBa_K3570007 parts work.

A. Protocols

Fresh yeast were grown in 25 ml of YPD medium overnight. This preculture was diluted to low OD_{600 nm} (e.g. 0.05) in 50 ml of fresh YPD medium. The biomass concentration was measured every two hours until it reaches an OD_{600 nm} of around 0.8. 50 ml of culture were transfered in a 50 ml falcon-tube and were centrifuged 5 minutes at 3000 rpm at room temperature. The supernatant was removed and 25 ml of LiAc/TE was added. The tube had to be thoroughly inverted 10 times. The tube was centrifuged 5 minutes at 3000 rpm at room temperature. The supernatant was removed and 400 µl of LiAc/TE was added. The tube had to be thoroughly inverted 10 times. Yeast competent cells should be used on the same day that they have been prepared.

A mix in a 1.5 ml microcentrifuge tube was prepared with 2 µl of transforming DNA (BBa_K3570000), 40 µl of competent yeast cells, 25 µg of carrier DNA (SS-DNA) and 168 µl of 50% PEG in 100 mM LiAc/TE.
Positive control was the same mixture but the transforming DNA was replaced by 1 µL of pR313. The negative control was the same mixture but had no transforming DNA. After vortexing, the solution was incubated 45 minutes at 30°C. 13 µl of DMS0 were added and the solution was vortexed again. It was centrifuged at 10,000 rpm for 1 minute. The supernatant was removed and the pellet was resuspended in 80 µl of NaCl. The solution was seeded on YNB Petri dish with all amino acids expect histidine since histidine was our selection marker. The Petri dish was incubated at 30°C for three days.

Verification of integration of BBa_K3570000 using the DPP1 homology sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit and the following primers: primer 1 (forward) hybridizes on our selectable marker HIS3 while primer 2 (reverse) hybridizes upstream of the DPP1 gene.

Primer 1: ATCAGGATTTGCGCCTTT

Primer 2: GCCGCCGAGGGTATTTTACTTCCG

B. Results and discussion

After 3 days, we were able to observe around 20 colonies in our yeast transformation, about the same amount on the positive control and none on the negative control plate. Eight clones were randomly chosen from our transformation and one from the positive control plate (figure 1) for PCR validation of the integration.

Figure 1: validation of the integration of the part BBa_K3570000 in the yeast genome using DPP1 homology sequence (BBa_3570006 and BBa_3570007). The expected correct size is 1.2kb.

All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band, proving that we have successfully integrated our construction into the yeast using DPP1 homology sequence.

References

• S. cerevisiae genome, chromosome IV, DPP1 gene. GenBank: CP046084.1

Sequence and Features