Difference between revisions of "Part:BBa K3338011"

 
(→‎Cloning)
 
(4 intermediate revisions by the same user not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K3338011 short</partinfo>
 
<partinfo>BBa_K3338011 short</partinfo>
 +
 +
===Usage and Biology===
  
 
The composite part described here exhibits an EGFP-MagA-P2A-hGLuc-cassette under the control of a CMV-enhancer/promoter for expression in mammalian cells. It was used to determine the expression of MagA and hGLuc at the same time from one promoter.
 
The composite part described here exhibits an EGFP-MagA-P2A-hGLuc-cassette under the control of a CMV-enhancer/promoter for expression in mammalian cells. It was used to determine the expression of MagA and hGLuc at the same time from one promoter.
  
−
<!-- Add more about the biology of this part here
+
=Cloning=
−
===Usage and Biology===
+
 
 +
 
 +
===Theoretical Part Design===
 +
 
 +
In order to test whether HeLa cells are able to simultaneously express MagA and hGLuc using a P2A-peptide, MagA and hGLuc were cloned into the pEGFP-C2 vector interspaced with P2A. In the resulting plasmid MagA is encoded with a N-terminal EGFP-tag making MagA detection very easy. The CMV promoter ensures constitutive and high expression rates mimicking the fully activated sensor.
 +
 
 +
===Sequence and Features===
  
−
<!-- -->
 
−
<span class='h3bb'>Sequence and Features</span>
 
 
<partinfo>BBa_K3338011 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K3338011 SequenceAndFeatures</partinfo>
  
  
−
<!-- Uncomment this to enable Functional Parameter display
+
===Cloning===
−
===Functional Parameters===
+
 
−
<partinfo>BBa_K3338011 parameters</partinfo>
+
The plasmid pEGFP-C2 (<html><a href=" https://parts.igem.org/Part:BBa_K3338020">BBa_K3338020</a></html>) was linearized with EcoRI and SalI. The MagA, P2A und hGLuc fragments were PCR amplified using the primers shown in table 1.
−
<!-- -->
+
 
 +
 
 +
 
 +
<html>
 +
 
 +
  <head>
 +
      <title>HTML Table Caption</title>
 +
  </head>
 +
 
 +
<body>
 +
<caption>Table1: Primers used to design the fragments.</caption>
 +
<table style="width:100%">
 +
  <tr>
 +
    <th>Primer name</th>
 +
    <th>Sequence</th>
 +
  </tr>
 +
  <tr>
 +
    <td>MagA_fw</td>
 +
    <td>TACAAGTCCGGCCGGACTCAGATCTCGAGCTCAAGCTTCGccatggacctgcatcatcc</td>
 +
  </tr>
 +
  <tr>
 +
    <td>MagA_rv</td>
 +
    <td>agcaggctgaagttagtagcgattccagtgccaggtccg</td>
 +
  </tr>
 +
  <tr>
 +
    <td>P2A_fw</td>
 +
    <td>ccggacctggcactggaatcgctactaacttcagcctgctgaag</td>
 +
  </tr>
 +
  <tr>
 +
    <td>P2A_rv</td>
 +
    <td>aacagaactttgactcccataggtccagggttctcctcc</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hGLuc_fw</td>
 +
    <td>tggaggagaaccctggacctatgggagtcaaagttctgtttgcc</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hGLuc_rv</td>
 +
    <td>CAGTTATCTAGATCCGGTGGATCCCGGGCCCGCGGTACCGttagtcaccaccggccccct</td>
 +
  </tr>
 +
</table>
 +
</body>
 +
 
 +
 
 +
</html>
 +
 
 +
 
 +
 
 +
These primers exhibit 5’ overhangs from approximately 20 bp length, that are designed using SnapGene allowing the assembly via the NEBuilder&#174; HiFi DNA Assembly Cloning Kit. The sequence of the part was verified by sanger sequencing. The vector map of the final construct is shown in figure 1.
 +
 
 +
 
 +
 
 +
<html>
 +
<center>
 +
<img src="https://2020.igem.org/wiki/images/f/f2/T--Hannover--parts_constD.png" style="width: 50%; height: 50%">
 +
</p>
 +
Figure 1: Vector map of the CMV-EGFP-MagA-P2A-hGLuc construct in pEGFP-C2.
 +
</center>
 +
</html>

Latest revision as of 00:21, 27 October 2020


CMV-EGFP-MagA-P2A-hGLuc

Usage and Biology

The composite part described here exhibits an EGFP-MagA-P2A-hGLuc-cassette under the control of a CMV-enhancer/promoter for expression in mammalian cells. It was used to determine the expression of MagA and hGLuc at the same time from one promoter.

Cloning

Theoretical Part Design

In order to test whether HeLa cells are able to simultaneously express MagA and hGLuc using a P2A-peptide, MagA and hGLuc were cloned into the pEGFP-C2 vector interspaced with P2A. In the resulting plasmid MagA is encoded with a N-terminal EGFP-tag making MagA detection very easy. The CMV promoter ensures constitutive and high expression rates mimicking the fully activated sensor.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 2553
    Illegal BsaI.rc site found at 1885
    Illegal BsaI.rc site found at 2434
    Illegal SapI site found at 1575


Cloning

The plasmid pEGFP-C2 (BBa_K3338020) was linearized with EcoRI and SalI. The MagA, P2A und hGLuc fragments were PCR amplified using the primers shown in table 1.


HTML Table Caption Table1: Primers used to design the fragments.

Primer name Sequence
MagA_fw TACAAGTCCGGCCGGACTCAGATCTCGAGCTCAAGCTTCGccatggacctgcatcatcc
MagA_rv agcaggctgaagttagtagcgattccagtgccaggtccg
P2A_fw ccggacctggcactggaatcgctactaacttcagcctgctgaag
P2A_rv aacagaactttgactcccataggtccagggttctcctcc
hGLuc_fw tggaggagaaccctggacctatgggagtcaaagttctgtttgcc
hGLuc_rv CAGTTATCTAGATCCGGTGGATCCCGGGCCCGCGGTACCGttagtcaccaccggccccct


These primers exhibit 5’ overhangs from approximately 20 bp length, that are designed using SnapGene allowing the assembly via the NEBuilder® HiFi DNA Assembly Cloning Kit. The sequence of the part was verified by sanger sequencing. The vector map of the final construct is shown in figure 1.


Figure 1: Vector map of the CMV-EGFP-MagA-P2A-hGLuc construct in pEGFP-C2.