Difference between revisions of "Part:BBa K3360003"

Latest revision as of 12:34, 27 October 2020

IARI-SP-2

Encoding the IARI-SP-2 endo-beta-1,4-glucanase of Bacillus subtilis, the entire sequence has been optimized by E.coli codons, and the N-terminus is marked with GST to increase its solubility and reduce the formation of inclusion bodies.

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
INCOMPATIBLE WITH RFC[25]
Illegal AgeI site found at 1587
1000
COMPATIBLE WITH RFC[1000]

SZU-China 2020 TEAM

The traditional fraying process is very harmful to the environment, resources and users. In essence, being old is the destruction of cellulose on the surface of jeans. We finally consider using cellulase to achieve this effect. Through cellulase washing, it can hydrolyze the cellulose and make a part of the dye fall off the fabric. Through this effect, the "worn feeling" effect that people want can be obtained.

We chose the endo-beta-1,4-glucanase IARI-SP-2 from B.subtilis. We loaded it into pGEX-4T-1-H vector as shown below. Under the induction of IPTG, IARI-SP-2 will be expressed in large quantities. For IARI-SP-2, we also have carried out codon optimization to optimize its expression in E.coli. with the GST tag.

Fig1. Plasmid vector diagram

We synthesized the above-mentioned vector and double digested it with BamHI and NotI. After DNA electrophoresis, the following map was obtained. The picture shows that after double enzyme digestion, the band 1 is lower than the band 2, and the size is about 5000bp, which is the same as our prediction, indicating that the gene transformation is successful.

Agarose-gel electrophoresis of IARI-SP-2.png

Fig.2 Agarose-gel electrophoresis of IARI-SP-2

Next, we did the polyacrylamide gel electrophoresis on the this protein expressions and observed obvious protein expressions as shown in the figure. The induced II group marked with a rectangular white box is our induced IARI-SP-2 endo-beta-1,4-glucanase.

Protein electrophoresis of IARI-SP-2.png

Fig.3 Protein electrophoresis of IARI-SP-2

We constructed a recombinant plasmid pGEX-4T-1-H- endo-beta-1,4-glucanase and transformed it into E.coli BL2l. After culture in a shaker at 37°C, bacterial were collected after IPTG expression was induced, and beta-glucosidase was collected after breaking. Before the specific measurement of enzyme activity, we drew the standard curve.

Fig.4 Glucose standard curve

Here, we define the cellulase activity concentration (U/ml) as the amount of 1μg reducing sugar produced per minute in a 1ml reaction system under the action of enzyme.

We characterized the activity of IARI-SP-2. We drew the enzyme activity-temperature curve as follows. It can be seen that 38℃ is the optimum temperature for IARI-SP-2. The enzyme activity reached 28.6964U/ml. We also measured the enzyme activity-time curves of IARI-SP-2 as follows. It can be seen that the enzymatic reaction rate becomes slower and slower as time flows by.

IARI-SP-2 enzyme activity-temperature curve.png

Fig.5 IARI-SP-2 enzyme activity-temperature curve

IARI-SP-2 enzyme activity-time curve.png

Fig.6 IARI-SP-2 enzyme activity-time curve

We took four cloths of equal mass, soaked them in the IARI-SP-2 crude enzyme solution and added an equal volume of pH=7 PBS buffer to dilute. The quality ratio of enzyme solution and denim was controlled at 80:1.

We put them in a flask and placed them in a shaker at room temperature (22°C) for shaking. After 48 hours, they were taken out for inspection, and the surface was photographed with an electron microscope to observe the destruction of the cellulose structure on the surface as shown below.

Fig.7 Denim treated by IARI-SP-2

The comparison shows that the fiber structure on the denim fiber bundle is basically intact before the enzyme treatment is added. After 48 hours of enzymatic treatment, the denim fiber bundle structure was obviously damaged, and significant faults and traces left by the cellulose chains were visible.

@@ Line 3: / Line 3: @@
 <partinfo>BBa_K3360003 short</partinfo>
-ATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGTTCCGCGTGGATCCATGAAACGTAGCATTAGCATCTTCATTACCTGCCTGCTGATCACCCTGCTGACCATGGGTGGCATGATGGCGAGCCCGGCGAGCGCGGCGGGTACCAAAACCCCGGTTGCGAAGAACGGCCAGCTGAGCATCAAGGGTACCCAACTGGTTAACCGTGATGGTAAAGCGGTGCAGCTGAAGGGTATTAGCAGCCACGGCCTGCAATGGTACGGTGAATATGTTAACAAAGACAGCCTGAAGTGGCTGCGTGACGATTGGGGTATCACCGTGTTTCGTGCGGCGATGTACACCGCGGATGGTGGCTATATTGATAACCCGAGCGTGAAGAACAAAGTTAAAGAGGCGGTGGAAGCGGCGAAAGAGCTGGGCATCTACGTGATCATTGACTGGCACATTCTGAACGATGGTAACCCGAACCAGAACAAAGAGAAGGCGAAAGAATTCTTTAAGGAGATGAGCAGCCTGTACGGCAACACCCCGAACGTTATCTATGAAATTGCGAACGAGCCGAACGGTGACGTGAACTGGAAACGTGATATCAAGCCGTATGCGGAGGAAGTGATCAGCGTTATTCGTAAAAACGACCCGGATAACATCATTATCGTTGGTACCGGCACCTGGAGCCAGGACGTGAACGATGCGGCGGACGATCAACTGAAGGATGCGAACGTTATGTACGCGCTGCACTTCTATGCGGGTACCCACGGCCAATTTCTGCGTGACAAAGCGAACTACGCGCTGAGCAAGGGTGCGCCGATCTTCGTTACCGAATGGGGTACCAGCGATGCGAGCGGTAACGGTGGCGTGTTTCTGGATCAGAGCCGTGAGTGGCTGAAATATCTGGACAGCAAGACCATTAGCTGGGTGAACTGGAACCTGAGCGATAAACAAGAAAGCAGCAGCGCGCTGAAGCCGGGTGCGAGCAAGACCGGTGGCTGGCGTCTGAGCGACCTGAGCGCGAGCGGCACCTTCGTTCGTGAGAACATCCTGGGTACCAAAGACAGCACCAAGGATATTCCGGAAACCCCGAGCAAGGATAAACCGACCCAGGAGAACGGTATCAGCGTGCAATACCGTGCGGGTGACGGCAGCATGAACAGCAACCAGATCCGTCCGCAGCTGCAAATTAAAAACAACGGCAACACCACCGTTGACCTGAAGGATGTGACCGCGCGTTACTGGTATAAGGCGAAAAACAAGGGTCAGAACGTTGACTGCGATTACGCGCAAATCGGTTGCGGCAACGTTACCCACAAATTCGTGACCCTGCACAAACCGAAGCAAGGCGCGGACACCTATCTGGAACTGGGTTTTAAGAACGGTACCCTGGCGCCGGGTGCGAGCACCGGCAACATTCAGCTGCGTCTGCACAACGACGATTGGAGCAACTACGCGCAAAGCGGTGATTACAGCTTCTTTAAGAGCAACACCTTCAAGACCACCAAGAAAATCACCCTGTACGACCAGGGCAAGCTGATTTGGGGTACCGAGCCGAACTAAGCGGCC
+Encoding the IARI-SP-2 endo-beta-1,4-glucanase of <i>Bacillus subtilis</i>, the entire sequence has been optimized by <i>E.coli</i> codons, and the N-terminus is marked with GST to increase its solubility and reduce the formation of inclusion bodies.
 <!-- Add more about the biology of this part here
@@ Line 11: / Line 11: @@
 <span class='h3bb'>Sequence and Features</span>
 <partinfo>BBa_K3360003 SequenceAndFeatures</partinfo>
+===SZU-China 2020 TEAM===
+The traditional fraying process is very harmful to the environment, resources and users. In essence, being old is the destruction of cellulose on the surface of jeans. We finally consider using cellulase to achieve this effect. Through cellulase washing, it can hydrolyze the cellulose and make a part of the dye fall off the fabric. Through this effect, the "worn feeling" effect that people want can be obtained.
+We chose the endo-beta-1,4-glucanase IARI-SP-2 from <i>B.subtilis</i>. We loaded it into pGEX-4T-1-H vector as shown below. Under the induction of IPTG, IARI-SP-2 will be expressed in large quantities. For IARI-SP-2, we also have carried out codon optimization to optimize its expression in <i>E.coli</i>. with the GST tag.
+[[File:IARI-SP-2 Plasmid vector diagram.png|500px|center]]
+<center>Fig1. Plasmid vector diagram</center>
+We synthesized the above-mentioned vector and double digested it with BamHI and NotI. After DNA electrophoresis, the following map was obtained. The picture shows that after double enzyme digestion, the band 1 is lower than the band 2, and the size is about 5000bp, which is the same as our prediction, indicating that the gene transformation is successful.
+[[File:Agarose-gel electrophoresis of IARI-SP-2.png |200px|center]]
+<center>Fig.2 Agarose-gel electrophoresis of IARI-SP-2</center>
+Next, we did the polyacrylamide gel electrophoresis on the this protein expressions and observed obvious protein expressions as shown in the figure. The induced II group marked with a rectangular white box is our induced IARI-SP-2 endo-beta-1,4-glucanase.
+[[File:Protein electrophoresis of IARI-SP-2.png |200px|center]]
+<center>Fig.3 Protein electrophoresis of IARI-SP-2</center>
+We constructed a recombinant plasmid pGEX-4T-1-H- endo-beta-1,4-glucanase and transformed it into <i>E.coli</i> BL2l. After culture in a shaker at 37°C, bacterial were collected after IPTG expression was induced, and beta-glucosidase was collected after breaking. Before the specific measurement of enzyme activity, we drew the standard curve.
+[[File:Glucose standard curve.png |400px|center]]
+<center>Fig.4  Glucose standard curve</center>
+Here, we define the cellulase activity concentration (U/ml) as the amount of 1μg reducing sugar produced per minute in a 1ml reaction system under the action of enzyme.
+We characterized the activity of IARI-SP-2. We drew the enzyme activity-temperature curve as follows. It can be seen that 38℃ is the optimum temperature for IARI-SP-2. The enzyme activity reached 28.6964U/ml. We also measured the enzyme activity-time curves of IARI-SP-2 as follows. It can be seen that the enzymatic reaction rate becomes slower and slower as time flows by.
+[[File:IARI-SP-2 enzyme activity-temperature curve.png |400px|center]]
+<center>Fig.5 IARI-SP-2 enzyme activity-temperature curve</center>
+[[File:IARI-SP-2 enzyme activity-time curve.png |400px|center]]
+<center>Fig.6 IARI-SP-2 enzyme activity-time curve</center>
+We took four cloths of equal mass, soaked them in the IARI-SP-2 crude enzyme solution and added an equal volume of pH=7 PBS buffer to dilute. The quality ratio of enzyme solution and denim was controlled at 80:1.
+We put them in a flask and placed them in a shaker at room temperature (22°C) for shaking. After 48 hours, they were taken out for inspection, and the surface was photographed with an electron microscope to observe the destruction of the cellulose structure on the surface as shown below.
+[[File:Denim treated by IARI-SP-2.png |400px|center]]
+<center>Fig.7 Denim treated by IARI-SP-2</center>
+The comparison shows that the fiber structure on the denim fiber bundle is basically intact before the enzyme treatment is added. After 48 hours of enzymatic treatment, the denim fiber bundle structure was obviously damaged, and significant faults and traces left by the cellulose chains were visible.