Difference between revisions of "Part:BBa K3075004"

Latest revision as of 02:26, 22 October 2019

His-mCerulean3-SnoopT

Introduction

mCerulean3 CFP (Cyan Fluorescent Protein) is an optimized FRET donor molecule that was rationally designed by Piston and co-workers to eliminate the excited-state heterogeneity of ECFP. In ECFP, a single-exponential fit to the fluorescence lifetime is not feasible due to multiple components, whereas mCerulean3 exhibits essentially homogeneous excited-state decay kinetics, rendering this protein useful for lifetime imaging. Live cell imaging experiments have demonstrated that mCerulean3 CFP undergoes highly efficient FRET to yellow acceptor molecules (25, 26). Additionally, mCerulean3 exhibits more than twice the brightness of ECFP and CyPet, emitting light at fluorescence intensities similar to Citrine (20).

Improvement

His-mCerulean3-SnoopT is an improvement by the 2019 UNSW iGEM team of mCerulean CFP.

The SnoopTag/SnoopCatcher system was adapted from an S. pneumoniae pilin as a protein ligation tool. The pilus adhesin protein, RrgA was split into two domains, SnoopCatcher and SnoopTag, which can covalently bind via an isopeptide bond when mixed together with over 99% yield [1]. SnoopCatcher and SnoopTag can be fused to other proteins, allowing for covalent interaction of these two proteins when mixed together via the isopeptide bond formed between the Tag and Catcher domains. SnoopTag/SnoopCatcher is orthogonal to SpyTag/SpyCatcher, meaning the two systems do not cross-react. Thus, Snoop-fusion proteins can be mixed with Spy-fusion proteins to create assemblies with greater complexity in one pot reactions. [2].

Additionally, as mCerulean3 is a fluorescent protein, protein expression and assembly of multiple constructs can be easily determined due to its ease in detection. By fusing the SnoopTag to a blue spectrum protein, it can be used alongside other types of fluorescent proteins, such as red, yellow and green fluorescent proteins, increasing the conveniency of verifying more complex assemblies. mCerulean3 is also a commonly used donor for Förster resonance energy transfer (FRET) when combined with fluorescent proteins in the yellow spectrum (such as mVenus) to demonstrate assembly. Currently only two parts exist on the registry with SnoopCatcher and none with SnoopTag. This is an important gap, as the orthogonality between the Snoop and Spy systems is currently underexploited in protein engineering. This improved part will thus be highly useful for future teams.

Primer-Directed Gene modification by PCR

Primers

Primers were designed for the addition of an N-terminal hexahistidine tag and Gibson overhangs to the 5’- and 3’- terminus of the CFP sequence. The primers used for modification are below:

• CFP Forward: 5’-ACTTTAAGAAGGAGATATACCATGCAC
• CFP Reverse: 5’-TCGGGCTTTGTTAGCAGCCGTCATTTGTTTACTTTAATGAACTCGATGTCGCCCAACTTACCTGATCCTTTATACAGTT

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) was used to modify and linearise the His-mCerulean3-SnoopT gene. PCR was performed using the following conditions:

Table 1: PCR Thermocycling conditions to amplify the His-mCerulean3-SnoopT gene fragment

Gradient annealing temperature can be used to empirically determine the optimal annealing temperature.

Detailed protocols here https://2019.igem.org/Team:UNSW_Australia/Protocols

PCR products were run on a 1% agarose gel in 1X TAE buffer for 1 hour at 100V and imaged in a GelDoc under the transilluminator setting (Figure omitted). Samples with amplicons of an approximate size of 800 bp was purified for further ligation. Circular template plasmids were cleaved by DpnI digestion and purified using a PCR clean up kit (QIAGEN). Purified amplicons were then ligated into the pET-19b backbone via Gibson Assembly.

Assembly of His-mCerulean3-SnoopT into pET-19b

Modified mCerulean3-SnoopTag was assembled into the pET-19b backbone by Gibson Assembly. A 3X molar excess of linear mCerulean3-SnoopT was incubated with linear pET-19b backbone and 2X Gibson Master Mix (NEB) at 50°C for 1 hour. The gibson mixture was transformed into T7 Express E. coli by heat shocking at 42°C for 10 seconds. Transformants were plated onto Luria Broth (LB) Agar plates supplemented with Ampicillin and incubated overnight at 37°C. Transformant colonies were screened using colony PCR under the same conditions as in Table 1. The Initial Denaturation step at 98°C was extended to 3 minutes for cell lysis.

Primers used for Colony PCR:

• T7 Forward : 5’-TAATACGACTCACTATAGGG
• T7 Reverse : 5’-GCTAGTTATTGCTCAGCGG

PCR products were run on a 1% agarose gel in 1X TAE buffer for 1 hour at 100V (Figure 2). Colonies obtaining amplicons with an observed molecular weight of approximately 800 bp were grown up overnight in a 5mL culture of Luria Broth supplemented with ampicillin. Plasmid DNA was extracted by miniprep and purified mCerulean3 constructs were submitted for sequence confirmation by Sanger sequencing.

Figure 2:Colony PCR gel image of recombinant His-mCerulean3-SnoopT-pET-19b plasmid. His-mCerulean3-SnoopT gene was amplified by colony PCR under the following conditions: 97°C for 3 minutes, 30X cycles at: 97°C for 10 seconds, 67.6°C for 30 seconds, 72°C for 15 seconds. Final extension at 72°C for 5 minutes. 10 uL of PCR product was run on a 1% agarose gel at 100 V for 1 hour using 5 uL of 2-log DNA ladder (NEB) as a standard (Lane 1). Single band obtained at approximately 800 bp.

Sequencing results confirm that the colony contains the recombinant His-mCerulean3-SnoopT gene in the pET-19b plasmid.

Protein purification Chromatography

His-mCerulean3-SnoopT was expressed and purified using a Ni-NTA column via the AKTAstart fast protein liquid chromatography (FPLC) system. Fractions thought to contain the His-tagged protein were determined by referring to the machine chromatogram and were then run on SDS-PAGE gel in Figure 3 below.

Figure 3: SDS-PAGE of AKTA purification fractions (F3-9 and F11) for His-mCerulean3-SnoopT protein.

Proof of conjugation

Elution fractions 8, 9, 10 and 11 (seen in Figure 3) were concentrated using an Amicon Ultra 15ml, 10KD concentrating column and conjugated with βPFD-SnoopCatcher in the molar ratios of 1:1, 1:2, and 2:1 (β:C) along with controls containing only βPFD-SnoopCatcher or His-mCerulean-SnoopT . This was repeated with purified fractions of mCerulean (no SnoopTag).

Figure 4: SDS-PAGE showing conjugation of βPFD-SnoopCatcher to mCerulean and His-mCerulean-SnoopT

Hexahistidine tags were added to both mCerulean3 and His-mCerulean3-SnoopT proteins to allow for purification by metal affinity chromatography (Figure 3). Addition of His-tags to both the original BioBrick part (mCerulean3) and improved part (His-mCerulean3-SnoopT) was essential to purify the proteins from contaminants as extra proteins may interfere with the conjugation of SnoopTag and SnoopCatcher. These purified proteins were then added to βPFD-SnoopCatcher in different molar ratios and incubated at 4°C overnight.

Figure 4 demonstrates good conjugation of His-mCerulean3-SnoopT to βPFD-SnoopCatcher, while no conjugation can be seen in samples containing mCerulean3 (without SnoopT).

References

1. Veggiani G, Nakamura T, Brenner MD, Gayet RV, Yan J, Robinson CV, Howarth M. Programmable polyproteams built using twin peptide superglues. Proceedings of the National Academy of Sciences. 2016 Feb 2;113(5):1202-7.
2. Brune KD, Buldun CM, Li Y, Taylor IJ, Brod F, Biswas S, Howarth M. Dual plug-and-display synthetic assembly using orthogonal reactive proteins for twin antigen immunization. Bioconjugate chemistry. 2017 May 5;28(5):1544-51.