Difference between revisions of "Part:BBa K2951004"

(→‎Characterization)
(→‎Structure Model)
 
(6 intermediate revisions by the same user not shown)
Line 26: Line 26:
 
<html>
 
<html>
 
<div style="padding-left:20%">
 
<div style="padding-left:20%">
−
     <img src=" https://2019.igem.org/wiki/images/a/a1/T--CSMU_Taiwan--npa-4_noncom.jpeg " style="width:400px; text-align: center;">
+
     <img src=" https://2019.igem.org/wiki/images/a/a1/T--CSMU_Taiwan--npa-4_noncom.jpeg " style="width:600px; text-align: center;">
 
   <br>
 
   <br>
 
   <p> Fig.1 (A)NPA-4 shows significant dose-dependent property. (B) We tested NPA-4 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-4 has the higher affinity toward NPA protein and lower affinity toward NPB which means higher specificity.
 
   <p> Fig.1 (A)NPA-4 shows significant dose-dependent property. (B) We tested NPA-4 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-4 has the higher affinity toward NPA protein and lower affinity toward NPB which means higher specificity.
Line 32: Line 32:
 
</div>
 
</div>
 
</html>
 
</html>
−
 
  
 
===Competitive ELISA===
 
===Competitive ELISA===
 
====Method====
 
====Method====
−
We set up different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.   
+
We set up different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coated these proteins each to a 96-well microplate. After blocking, primary antibodies were added, which was the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.   
 
*NPB: this is the abbreviation for nucleoprotein of Influenza B virus (B/Colorado/16/2017) nucleoprotein and it act as a non-target protein in this ELISA experiment.
 
*NPB: this is the abbreviation for nucleoprotein of Influenza B virus (B/Colorado/16/2017) nucleoprotein and it act as a non-target protein in this ELISA experiment.
  
Line 42: Line 41:
 
<html>
 
<html>
 
<div style="padding-left:20%">
 
<div style="padding-left:20%">
−
     <img src=" https://2019.igem.org/wiki/images/e/e1/T--CSMU_Taiwan--NP4-2.jpeg" style="width:400px; text-align: center;">
+
     <img src=" https://2019.igem.org/wiki/images/e/e1/T--CSMU_Taiwan--NP4-2.jpeg" style="width:600px; text-align: center;">
 
   <br>
 
   <br>
−
   <p> Fig3A. The x axis represents the amount competitive protein added in the solution, and the y axis is the OD value measured. (A)When increasing the amount of competitive protein (target: influenza A nucleocapsid protein in affinity test), the OD value decrease shows that the free protein in the solution is capable of grabbing our aptamers. (B)When increasing the amount of competitive protein (non-target: influenza B protein in specificity test) there was no significant decrease in measured OD value, proving its specificity.
+
   <p> Fig2A. The x axis represents the amount competitive protein added in the solution, and the y axis is the OD value measured. (A)When increasing the amount of competitive protein (target: influenza A nucleocapsid protein in affinity test), the OD value decrease shows that the free protein in the solution was capable of grabbing our aptamers. (B)When increasing the amount of competitive protein (non-target: influenza B protein in specificity test) there was no significant decrease in measured OD value, proving its specificity.
 
</p>
 
</p>
 
</div>
 
</div>
 
</html>
 
</html>
 +
 
===Structure Model===
 
===Structure Model===
 
<html>
 
<html>
−
<p>We modeled the aptamer in 2D and 3D structure as an approach to gaining insights for further optimization. Modeled results are shown in Fig3. Our conformation modeling are based on 0℃ due to the aptamer refolding process during selection was practiced at 0℃.</p>
+
<p>We modeled the aptamer in 2D and 3D structure as an approach to gaining insights for further optimization. Modeled results are shown in Fig3 and 4. Our conformation modeling are based on 0℃ due to the aptamer refolding process during selection was practiced at 0℃.</p>
 
<div style="padding-left:20%">
 
<div style="padding-left:20%">
 
     <img src=" https://2019.igem.org/wiki/images/f/f9/T--CSMU_Taiwan--NP4-3.jpeg
 
     <img src=" https://2019.igem.org/wiki/images/f/f9/T--CSMU_Taiwan--NP4-3.jpeg
Line 56: Line 56:
 
   <br>
 
   <br>
 
   <p> Fig3a. The sequence of NPA-4 were sent to <a href="http://unafold.rna.albany.edu/?q=mfold"> Mfold</a> server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above.
 
   <p> Fig3a. The sequence of NPA-4 were sent to <a href="http://unafold.rna.albany.edu/?q=mfold"> Mfold</a> server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above.
−
Fig.3b The 3D structure of NPA-4 is predicted utilizing <a href="http://rnacomposer.cs.put.poznan.pl/ "> RNAcomposer</a> operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure.
+
Fig.3b The 3D structure of NPA-4 is predicted utilizing <a href="http://rnacomposer.cs.put.poznan.pl/ "> RNAcomposer</a> operated on the RNA FRABASE database and could fully automatically predict the RNA 3D structure.
 
</p>
 
</p>
 
</div>
 
</div>
Line 64: Line 64:
 
     <img src=" https://2019.igem.org/wiki/images/c/cb/T--CSMU_Taiwan--NP4-4.png" style="width:400px; text-align: center;">
 
     <img src=" https://2019.igem.org/wiki/images/c/cb/T--CSMU_Taiwan--NP4-4.png" style="width:400px; text-align: center;">
 
   <br>
 
   <br>
−
   <p> Fig.5Docking structural model of AptNPA-4 with NPA. (visualization by  <a href="https://www.ncbi.nlm.nih.gov/Structure/icn3d/full.html"> iCn3D</a>)
+
   <p> Fig.4 Docking structural model of AptNPA-4 with NPA. (visualization by  <a href="https://www.ncbi.nlm.nih.gov/Structure/icn3d/full.html"> iCn3D</a>)
 
</p>
 
</p>
 
</div>
 
</div>

Latest revision as of 01:37, 22 October 2019


Apt-influenzaA-NP

This part is a ssDNA aptamer that targets the nucleocapsid protein of influenza A virus (A/Michigan/297/2017(H1N1), sequence from NCBI(CY261696.1) gene:34-1530). The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “NPA-4” due to the target protein it should recognize and our label with number during experimental process.

Characterization

Titer value

The titer value of this aptamer towards its target protein nucleocaspid is determined by practicing two types of ELISA. According to the coated protein, two important factors are tested.

  • Affinity-by coating target protein
  • Specificity-by coating un-target protein.

Non-competitive ELISA

Method

We set up different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.

  • NPB: this is the abbreviation for nucleoprotein of Influenza B virus (B/Colorado/16/2017) nucleoprotein and it act as a non-target protein in this ELISA experiment.

Result


Fig.1 (A)NPA-4 shows significant dose-dependent property. (B) We tested NPA-4 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-4 has the higher affinity toward NPA protein and lower affinity toward NPB which means higher specificity.

Competitive ELISA

Method

We set up different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coated these proteins each to a 96-well microplate. After blocking, primary antibodies were added, which was the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.

  • NPB: this is the abbreviation for nucleoprotein of Influenza B virus (B/Colorado/16/2017) nucleoprotein and it act as a non-target protein in this ELISA experiment.

Result


Fig2A. The x axis represents the amount competitive protein added in the solution, and the y axis is the OD value measured. (A)When increasing the amount of competitive protein (target: influenza A nucleocapsid protein in affinity test), the OD value decrease shows that the free protein in the solution was capable of grabbing our aptamers. (B)When increasing the amount of competitive protein (non-target: influenza B protein in specificity test) there was no significant decrease in measured OD value, proving its specificity.

Structure Model

We modeled the aptamer in 2D and 3D structure as an approach to gaining insights for further optimization. Modeled results are shown in Fig3 and 4. Our conformation modeling are based on 0℃ due to the aptamer refolding process during selection was practiced at 0℃.


Fig3a. The sequence of NPA-4 were sent to Mfold server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above. Fig.3b The 3D structure of NPA-4 is predicted utilizing RNAcomposer operated on the RNA FRABASE database and could fully automatically predict the RNA 3D structure.


Fig.4 Docking structural model of AptNPA-4 with NPA. (visualization by iCn3D)


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]