Difference between revisions of "Part:BBa K2951009"
(→Characterization) |
|||
(16 intermediate revisions by 3 users not shown) | |||
Line 3: | Line 3: | ||
<partinfo>BBa_K2951009 short</partinfo> | <partinfo>BBa_K2951009 short</partinfo> | ||
− | |||
− | + | <html> | |
− | This part is a ssDNA aptamer that targets the nucleoprotein of influenza A virus (A/Michigan/297/2017(H1N1), sequence from[ https://www.ncbi.nlm.nih.gov/nuccore/CY261696.1 NCBI(CY261696.1)]. The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “NPA-5” due to the target protein it should recognize and our label with number during experimental process. | + | </p> |
+ | </html> | ||
+ | __TOC__ | ||
+ | |||
+ | ==Usage and Biology== | ||
+ | This part is a ssDNA aptamer that targets the nucleoprotein of influenza A virus (A/Michigan/297/2017(H1N1), sequence from [https://www.ncbi.nlm.nih.gov/nuccore/CY261696.1 NCBI(CY261696.1)]. The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “NPA-5” due to the target protein it should recognize and our label with number during experimental process. | ||
+ | |||
==Characterization== | ==Characterization== | ||
===Titer value=== | ===Titer value=== | ||
− | + | ||
− | + | The titer value of this aptamer towards its target protein nucleocaspid is determined by practicing two types of ELISA. According to the coated protein, two important factors are tested: | |
− | + | ||
+ | *Affinity-by coating target protein | ||
+ | *Specificity-by coating un-target protein. | ||
+ | |||
===Non-competitive ELISA=== | ===Non-competitive ELISA=== | ||
− | ===Method=== | + | ====Method==== |
We set up with different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm. | We set up with different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm. | ||
− | + | *NPB: this is the abbreviation for nucleoprotein of Influenza B virus (B/Colorado/16/2017) nucleoprotein and it act as a non-target protein in this ELISA experiment. | |
− | ===Result=== | + | ====Result==== |
<html> | <html> | ||
<div style="padding-left:20%"> | <div style="padding-left:20%"> | ||
− | <img src="https://2019.igem.org/wiki/images/a/a1/T--CSMU_Taiwan--npa-4_noncom.jpeg" style="width: | + | <img src="https://2019.igem.org/wiki/images/a/a1/T--CSMU_Taiwan--npa-4_noncom.jpeg" style="width:600px; text-align: center;"> |
<br> | <br> | ||
<p> Fig.1 (A)NPA-5 shows significant dose-dependent property. (B) We tested NPA-5 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-5 has higher affinity toward NPA and lower affinity toward NPB which means higher specificity. | <p> Fig.1 (A)NPA-5 shows significant dose-dependent property. (B) We tested NPA-5 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-5 has higher affinity toward NPA and lower affinity toward NPB which means higher specificity. | ||
Line 28: | Line 36: | ||
</div> | </div> | ||
</html> | </html> | ||
+ | |||
===Competitive ELISA=== | ===Competitive ELISA=== | ||
− | ===Method=== | + | ====Method==== |
We coated the HA1 and HA3 each to a 96-well microplate, each well containing the same amount. After blocking, primary antibodies were added, which is the selected aptamers. At the same time, add the same kind of protein with the coated ones in different concentration as competitive. OD value was then measured by ELISA reader at the wave length of 450nm. If the protein added in the solution which compete with the coated protein could significantly grab our aptamer and left the plate by washing, we can say the aptamer have high affinity to the protein we tested. | We coated the HA1 and HA3 each to a 96-well microplate, each well containing the same amount. After blocking, primary antibodies were added, which is the selected aptamers. At the same time, add the same kind of protein with the coated ones in different concentration as competitive. OD value was then measured by ELISA reader at the wave length of 450nm. If the protein added in the solution which compete with the coated protein could significantly grab our aptamer and left the plate by washing, we can say the aptamer have high affinity to the protein we tested. | ||
− | ===Result=== | + | ====Result==== |
<html> | <html> | ||
<div style="padding-left:20%"> | <div style="padding-left:20%"> | ||
− | <img src=" https://2019.igem.org/wiki/images/a/ab/T--CSMU_Taiwan--NPA-5b.jpeg" style="width: | + | <img src=" https://2019.igem.org/wiki/images/a/ab/T--CSMU_Taiwan--NPA-5b.jpeg" style="width:600px; text-align: center;"> |
<br> | <br> | ||
− | <p> | + | <p> Fig.2 The x axis represents the amount competitive protein added in the solution, and the y axis is the OD value measured. (A) When increasing the amount of competitive protein (target: influenza A nucleocapsid protein in affinity test), the OD value decrease shows that the free protein in the solution is capable of grabbing our aptamers. (B)When increasing the amount of competitive protein (non-target: influenza B protein in specificity test) there was n decrease in measured OD value, proving its specificity. |
</p> | </p> | ||
</div> | </div> | ||
</html> | </html> | ||
+ | |||
+ | ===Structure Model=== | ||
<html> | <html> | ||
+ | <p>We modeled the aptamer in 2D and 3D structure as an approach to gaining insights for further optimization. Modeled results are shown in Fig3. Our conformation modeling are based on 0℃ due to the aptamer refolding process during selection was practiced at 0℃. </p> | ||
+ | |||
<div style="padding-left:20%"> | <div style="padding-left:20%"> | ||
− | <img src="https://2019.igem.org/wiki/images/3/3a/T--CSMU_Taiwan--NPA-5c.jpeg" style="width: | + | <img src="https://2019.igem.org/wiki/images/3/3a/T--CSMU_Taiwan--NPA-5c.jpeg" style="width:600px; text-align: center;"> |
<br> | <br> | ||
− | <p> | + | <p> Fig.3a The sequence of NPA-5 were sent to <a href="http://unafold.rna.albany.edu/?q=mfold"> Mfold</a> server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above. |
Fig.3b The 3D structure of NPA-5 is predicted utilizing <a href="http://rnacomposer.cs.put.poznan.pl/"> RNAcompose</a> operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure. | Fig.3b The 3D structure of NPA-5 is predicted utilizing <a href="http://rnacomposer.cs.put.poznan.pl/"> RNAcompose</a> operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure. | ||
</p> | </p> |
Latest revision as of 01:40, 22 October 2019
Apt-influenzaA-NP
Contents
Usage and Biology
This part is a ssDNA aptamer that targets the nucleoprotein of influenza A virus (A/Michigan/297/2017(H1N1), sequence from NCBI(CY261696.1). The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “NPA-5” due to the target protein it should recognize and our label with number during experimental process.
Characterization
Titer value
The titer value of this aptamer towards its target protein nucleocaspid is determined by practicing two types of ELISA. According to the coated protein, two important factors are tested:
- Affinity-by coating target protein
- Specificity-by coating un-target protein.
Non-competitive ELISA
Method
We set up with different concentration of target protein(NPA) and non-target protein(NPB) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.
- NPB: this is the abbreviation for nucleoprotein of Influenza B virus (B/Colorado/16/2017) nucleoprotein and it act as a non-target protein in this ELISA experiment.
Result
![](https://2019.igem.org/wiki/images/a/a1/T--CSMU_Taiwan--npa-4_noncom.jpeg)
Fig.1 (A)NPA-5 shows significant dose-dependent property. (B) We tested NPA-5 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-5 has higher affinity toward NPA and lower affinity toward NPB which means higher specificity.
Competitive ELISA
Method
We coated the HA1 and HA3 each to a 96-well microplate, each well containing the same amount. After blocking, primary antibodies were added, which is the selected aptamers. At the same time, add the same kind of protein with the coated ones in different concentration as competitive. OD value was then measured by ELISA reader at the wave length of 450nm. If the protein added in the solution which compete with the coated protein could significantly grab our aptamer and left the plate by washing, we can say the aptamer have high affinity to the protein we tested.
Result
![]( https://2019.igem.org/wiki/images/a/ab/T--CSMU_Taiwan--NPA-5b.jpeg)
Fig.2 The x axis represents the amount competitive protein added in the solution, and the y axis is the OD value measured. (A) When increasing the amount of competitive protein (target: influenza A nucleocapsid protein in affinity test), the OD value decrease shows that the free protein in the solution is capable of grabbing our aptamers. (B)When increasing the amount of competitive protein (non-target: influenza B protein in specificity test) there was n decrease in measured OD value, proving its specificity.
Structure Model
We modeled the aptamer in 2D and 3D structure as an approach to gaining insights for further optimization. Modeled results are shown in Fig3. Our conformation modeling are based on 0℃ due to the aptamer refolding process during selection was practiced at 0℃.
![](https://2019.igem.org/wiki/images/3/3a/T--CSMU_Taiwan--NPA-5c.jpeg)
Fig.3a The sequence of NPA-5 were sent to Mfold server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above. Fig.3b The 3D structure of NPA-5 is predicted utilizing RNAcompose operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 33
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]