Difference between revisions of "Part:BBa K3254004"

(→‎Genetic Design)
 
(8 intermediate revisions by one other user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K3254004 short</partinfo>
 
<partinfo>BBa_K3254004 short</partinfo>
  
−
We expected that this part can be placed between a promoter and a translational unit part and work as a normally open (NO) switch for the downstreamed gene. and switch to ON state by excising the terminator ECK120020525 between the att sites when it reacted with Int10 integrase (BBa_K3254009). Two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it was excised.  
+
We expected that this part can be placed between a promoter and a translational unit part and work as a normally open (NO) switch for the downstreamed gene. and switch to ON state by excising the terminator ECK120020525 between the att sites when it reacted with Int10 integrase ([[Part:BBa_K3254009|BBa_K3254009). Two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it was excised.  
  
 
=Usage and Biology=
 
=Usage and Biology=
−
==Visual Result as a Normally Closed Switch==
+
==Visual Result as a Normally Open Switch==
 
*We conducted a simple test to see if our design met the expection.
 
*We conducted a simple test to see if our design met the expection.
  
 
===Experimental Setup===
 
===Experimental Setup===
−
*Genetic design principle of the experimental group is described on the page of [[Part:BBa_K3254012|BBa_K3254012]].
+
*Genetic design principle of the experimental group was described on the page of [[Part:BBa_K3254012|BBa_K3254012]].
 
*A P15A-AmpR plasmid was co-transfered into the E.coli DH5α host cell with the reporter plasmid containing this part as the negative control.
 
*A P15A-AmpR plasmid was co-transfered into the E.coli DH5α host cell with the reporter plasmid containing this part as the negative control.
 
*Single colonies were selected from the experimental LB-agar plate and negative control LB-agar plate, then inoculated into EP tubes with 500 μL M9 supplemented medium containing 500 μM IPTG for overnight growth at 37 °C and 200 rpm.
 
*Single colonies were selected from the experimental LB-agar plate and negative control LB-agar plate, then inoculated into EP tubes with 500 μL M9 supplemented medium containing 500 μM IPTG for overnight growth at 37 °C and 200 rpm.
 
*Tubes were centrifuged at 10000g for 1 min. Then observed the GFP fluorescence of the cell precipitations under blue light.
 
*Tubes were centrifuged at 10000g for 1 min. Then observed the GFP fluorescence of the cell precipitations under blue light.
 +
*M9 medium (supplemented）: 6.8 g/L Na<sub>2</sub>HPO<sub>4</sub>, 3 g/L KH<sub>2</sub>PO<sub>4</sub>, 0.5 g/L NaCl, 1 g/L NH<sub>4</sub>Cl, 0.34 g/L thiamine, 0.2% casamino acids, 0.4% glucose, 2mM MgSO<sub>4</sub>, and 100 μM CaCl<sub>2</sub>.
  
 
===Results===
 
===Results===
−
*IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respctively.
+
*IBR-[[Part:BBa_K3254000|C35]]/[[Part:BBa_K3254001|F55]]/[[Part:BBa_K3254002|S37]]/[[Part:BBa_K3254003|E21]]/[[Part:BBa_K3254004|T25]]/[[Part:BBa_K3254005|G22]] indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respectively.
 
*We observed the GFP fluorescence from the experimental tube as expected.<br>
 
*We observed the GFP fluorescence from the experimental tube as expected.<br>
  
−
[[File:T--GENAS_China--primary_screening.png|600px|thumb|center| ]]<br>
+
[[File:T--GENAS_China--primary_screening.png|600px|thumb|center|Visual Results as Normally Open Switches]]<br>
  
 
==Quantitative Characterizaion of the Normally Open Switch==
 
==Quantitative Characterizaion of the Normally Open Switch==
Line 29: Line 30:
  
 
===Results===
 
===Results===
−
*IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respctively.
+
*IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respectively.
 
*Compared to other parts, this part performed well.<br>
 
*Compared to other parts, this part performed well.<br>
  
−
[[File:T--GENAS_China--primary_quantitative_characterizaion.png|600px|thumb|center| ]]<br>
+
[[File:T--GENAS_China--primary_quantitative_characterization.png|600px|thumb|center|Quantitative Characterization of the Normally Open Switches]]<br>
  
−
==Visual Results as a Normally Closed Switch and Toggle Switch==
+
==Thermodynamic Characterization==
−
*We inserted an [[Part:BBa_E2060|mCherry]] translational unit between the two BsaI sites.
+
See the related information on the page of [[Part:BBa_K3254012|BBa_K3254012]].
−
*Other experiment setup were the same with "Visual Result as a Normally Closed Switch".
+
  
−
===Results===
 
−
*The normally open switch function well.
 
−
*At the same time, the downstreamed GFP also expressed well which indicated this part can also function as a toggle switch.
 
−
[[File:T--GENAS_China--INT10_NC_switch.png]]
 
  
 
==Orthogonality Characterization==
 
==Orthogonality Characterization==
Line 48: Line 44:
 
*The composition and principle of the experimental system are indicated below.  
 
*The composition and principle of the experimental system are indicated below.  
  
−
[[File:T--GENAS_China--excision_with_backbone.PNG|200px|thumb|left| ]]
+
[[File:T--GENAS_China--excision_with_backbone.PNG|200px|thumb|left|The composition and principle of the experimental system]]
  
 
===Experimental Setup===
 
===Experimental Setup===
Line 57: Line 53:
 
===Results===
 
===Results===
 
*IBR-T25 was the plasmid containing this part.
 
*IBR-T25 was the plasmid containing this part.
−
*The result indicates that this part can only be recombined by int10 integrase.
+
*The result indicates that this part can only be recombined by int 10 integrase.
 
*The sequence (attL or attR) after recombination is agcacgctgataatcagcaagaccaccaacatttcaatcaaggatagtaaaactctcactctt.
 
*The sequence (attL or attR) after recombination is agcacgctgataatcagcaagaccaccaacatttcaatcaaggatagtaaaactctcactctt.
  
−
[[File:T--GENAS_China--orthogonality_test.png]]
+
[[File:T--GENAS_China--orthogonality_test. png]]
  
  

Latest revision as of 12:37, 21 October 2019


Int10attB-BsaI site-terminator-Int10attP

We expected that this part can be placed between a promoter and a translational unit part and work as a normally open (NO) switch for the downstreamed gene. and switch to ON state by excising the terminator ECK120020525 between the att sites when it reacted with Int10 integrase ([[Part:BBa_K3254009|BBa_K3254009). Two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it was excised.

Usage and Biology

Visual Result as a Normally Open Switch

  • We conducted a simple test to see if our design met the expection.

Experimental Setup

  • Genetic design principle of the experimental group was described on the page of BBa_K3254012.
  • A P15A-AmpR plasmid was co-transfered into the E.coli DH5α host cell with the reporter plasmid containing this part as the negative control.
  • Single colonies were selected from the experimental LB-agar plate and negative control LB-agar plate, then inoculated into EP tubes with 500 μL M9 supplemented medium containing 500 μM IPTG for overnight growth at 37 °C and 200 rpm.
  • Tubes were centrifuged at 10000g for 1 min. Then observed the GFP fluorescence of the cell precipitations under blue light.
  • M9 medium (supplemented）: 6.8 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 0.34 g/L thiamine, 0.2% casamino acids, 0.4% glucose, 2mM MgSO4, and 100 μM CaCl2.

Results

  • IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respectively.
  • We observed the GFP fluorescence from the experimental tube as expected.
Visual Results as Normally Open Switches

Quantitative Characterizaion of the Normally Open Switch

Experimental Setup

  • Bacteria harboring the circuits (see the top part of the result image) first inoculated from single colonies into a flat-bottom 96-well plate for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium with 500 μM IPTG inducer and growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, 3-μL samples each culture were transferred to a new 96-well plate containing 200 μL per well of PBS supplemented with 2 mg/mL kanamycin.
  • The fluorescence distribution of each sample was assayed using a flow cytometry. The arithmetical mean of each sample was determined using FlowJo software.
  • The principle of data processing is shown on the result image.

Results

  • IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respectively.
  • Compared to other parts, this part performed well.
File:T--GENAS China--primary quantitative characterization.png
Quantitative Characterization of the Normally Open Switches

Thermodynamic Characterization

See the related information on the page of BBa_K3254012.


Orthogonality Characterization

Genetic Design

  • The composition and principle of the experimental system are indicated below.
The composition and principle of the experimental system

Experimental Setup

The reporter plasmid contained this part were co-transferred into E.coli DH5α host with 6 integrase generator plasmids. Then single colonies were inoculated into M9 supplemented medium for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium with 500 μM IPTG inducer and growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, The cultures were sampled for genotype PCR testing. The principle of genotype identification was shown on the right of results image.

Results

  • IBR-T25 was the plasmid containing this part.
  • The result indicates that this part can only be recombined by int 10 integrase.
  • The sequence (attL or attR) after recombination is agcacgctgataatcagcaagaccaccaacatttcaatcaaggatagtaaaactctcactctt.

File:T--GENAS China--orthogonality test. png


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 76
    Illegal BsaI.rc site found at 64