Difference between revisions of "Part:BBa K2983030"

(→‎References)
 
(43 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2983030 short</partinfo>
 
<partinfo>BBa_K2983030 short</partinfo>
  
−
YL-pOdd1 is used for the assembly of Transcriptional units that will be in Position 1 at the Even Level. It presents the following loop sites: Loop Alpha-A ([[BBa_K2983010|BBa_K2983010]]) & Loop F-Beta ([[BBa_K2983011|BBa_K2983011]]) .
+
YL-pOdd1 belongs to a collection of parts that compose the Loop assembly system dedicated to the oleaginous yeast ''Yarrowia lipolytica'' (see full description bellow).
 +
This system makes fast and efficient cloning possible by Golden Gate. It offers modularity for assembling complex genetic circuits and their subsequent transfer and integration into the ''Yarrowia lipolytica'' genome.  
  
−
===Overview===
+
YL-pOdd1 presents 2 loop sites: Loop Alpha-A ([[Part:BBa_K2983010|BBa_K2983010]]) & Loop F-Beta ([[Part:BBa_K2983011|BBa_K2983011]]) and thus allows assembly of transcriptional units that will be in Position 1 at the Even Level.
 +
 
 +
This part works as expected: we successfully used it to build several expression cassettes ([[Part:BBa_K2983170|BBa_K2983170]], [[Part:BBa_K2983171|BBa_K2983171]], [[Part:BBa_K2983172|BBa_K2983172]], [[Part:BBa_K2983173|BBa_K2983173]], [[Part:BBa_K2983174|BBa_K2983174]], [[Part:BBa_K2983175|BBa_K2983175]], [[Part:BBa_K2983176|BBa_K2983176]], [[Part:BBa_K2983177|BBa_K2983177]], [[Part:BBa_K2983178|BBa_K2983178]], [[Part:BBa_K2983181|BBa_K2983181]], [[Part:BBa_K2983182|BBa_K2983182]]) that we subsequently integrated in the genome of ''Yarrowia lipolytica'' ''ura3-302'' strains and characterised their function.
 +
 
 +
We also used transformed directly this part in ''Yarrowia lipolytica'' and build negative controls for our experiments.
 +
 
 +
===Usage and Biology===
 +
 
 +
====Overview====
  
 
Golden Gate [1, 2] is a powerful molecular biology technique that allows scarless assembly of a large number of DNA fragments. It makes use of type IIS restriction enzymes, such as BsaI, BsmBI, BbsI, SapI, etc., that have the peculiarity of having a recognition site outside their cutting site. This property gives several advantages during cloning:
 
Golden Gate [1, 2] is a powerful molecular biology technique that allows scarless assembly of a large number of DNA fragments. It makes use of type IIS restriction enzymes, such as BsaI, BsmBI, BbsI, SapI, etc., that have the peculiarity of having a recognition site outside their cutting site. This property gives several advantages during cloning:
  
−
It allows scarless assembly: the cutting sites can be designed so that upon digestion and ligation, the final construct has only the desired sequence without the recognition sites.
+
* It allows scarless assembly: the cutting sites can be designed so that upon digestion and ligation, the final construct has only the desired sequence without the recognition sites.
  
−
It allows assembly of a large number of fragments in a defined order: the cutting sites can be diverse and generate several overhangs after digestion that can be ligated easily and specifically, based on complementarity.
+
* It allows assembly of a large number of fragments in a defined order: the cutting sites can be diverse and generate several overhangs after digestion that can be ligated easily and specifically, based on complementarity.
  
−
It allows one pot digestion and ligation: the ligation is irreversible and the final DNA molecule will persist because there is no possibility of recreating the restriction sites. Thus, during the reaction, the final construct continues to accumulate, which increases the overall cloning efficiency.
+
* It allows one pot digestion and ligation: the ligation is irreversible and the final DNA molecule will persist because there is no possibility of recreating the restriction sites. Thus, during the reaction, the final construct continues to accumulate, which increases the overall cloning efficiency.
  
 
Golden Gate cloning allows great freedom in design and can employed for building custom made DNA molecules. For these reasons it was adopted by the scientific community who recognised its potential even for developing standardized and modular cloning. Thus, several Golden Gate based tool kits were constructed both for prokaryotes and eukaryotes [3-7 for example]. The recently published Loop assembly system [8] brings Golden Gate cloning to a higher level of creativity and modularity as it allows recursive assembly of DNA fragments.
 
Golden Gate cloning allows great freedom in design and can employed for building custom made DNA molecules. For these reasons it was adopted by the scientific community who recognised its potential even for developing standardized and modular cloning. Thus, several Golden Gate based tool kits were constructed both for prokaryotes and eukaryotes [3-7 for example]. The recently published Loop assembly system [8] brings Golden Gate cloning to a higher level of creativity and modularity as it allows recursive assembly of DNA fragments.
  
−
We welcome the iGEM initiative to fully support Type IIS parts that adhere to the MoClo/ PhytoBricks and Loop Type IIS assembly standards for the first time in the 2019 Competition https://2019.igem.org/Competition/New/Type_IIS
+
====A Type IIS RFC[10] Loop assembly system for ''Yarrowia lipolytica''====
−
In this framework, we designed a Loop assembly system dedicated to our chassis, the oleaginous yeast Yarrowia lipolytica.
+
  
−
===A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica===
+
The general architecture of the ''Yarrowia lipolytica'' Loop assembly platform is depicted in Figure 1. It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the following features:
  
−
The general architecture of the Yarrowia lipolytica Loop assembly platform is depicted in Figure 1. It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the following features:
+
* Two Zeta sequences, Zeta Up ([[Part:BBa_K2983000|BBa_K2983000]]) and Zeta Down ([[Part:BBa_K2983001|BBa_K2983001]]), are flanking the platform. Zeta sequences [9] allow random integrations in ''Yarrowia lipolytica'' Po1d strain JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which has the zeta platform at the ''ura3-302'' locus or JMY1212 [12] which has the zeta platform at the ''leu2-270'' locus.
  
−
Two Zeta sequences, Zeta Up (BBa_K2983000) and Zeta Down (BBa_K2983001), are flanking the platform. Zeta sequences [9] allow random integrations in Yarrowia lipolytica Po1d strain JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which has the zeta platform at the ura3-302 locus or JMY1212 [12] which has the zeta platform at the leu2-270 locus.
+
* The ''URA3'' auxotrophic selection marker [13] ([[Part:BBa_K2983005|BBa_K2983005]]) which is composed of the ''URA3'' promoter ([[Part:BBa_K2983002|BBa_K2983002]]), ''URA3'' gene ([[Part:BBa_K2983003|BBa_K2983003]]) and the ''URA3'' terminator ([[Part:BBa_K2983004|BBa_K2983004]]). The ''URA3'' gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23) that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells are able to grow only if uracil or uridine is supplemented in the media. The ''Yarrowia lipolytica'' Loop assembly platform having this auxotrophic selection marker needs to be used in Δ''ura'' strains.
  
−
The URA3 auxotrophic selection marker [13] (BBa_K2983005) which is composed of the URA3 promoter (BBa_K2983002), URA3 gene (BBa_K2983003) and the URA3 terminator (BBa_K2983004). The URA3 gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23) that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells are able to grow only if uracil or uridine is supplemented in the media. The Yarrowia lipolytica Loop assembly platform having this auxotrophic selection marker needs to be used in Δura strains.
+
* Two traditional cloning sites (BamHI and HindIII) are flanking the ''URA3'' auxotrophic selection marker to allow, if needed, changing it to other selection markers like ''LEU2'' [13], ''LYS5'' [14] or ''HygR'' [13].
  
−
Two traditional cloning sites (BamHI and HindIII) are flanking the URA3 auxotrophic selection marker to allow, if needed, changing it to other selection markers like LEU2 [13], LYS5 [14] or HygR [13].
+
* The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information) and two SfiI sites in between to allow, if needed, the insertion of ''E. coli'' cloning selection markers like LacZalpha ([[Part:BBa_K2448003|BBa_K2448003]]) or reporter RFP ([[Part:BBa_J04450|BBa_J04450]]) expression cassettes.
  
−
The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information) and two SfiI sites in between to allow, if needed, the insertion of E. coli cloning selection markers like LacZalpha (BBa_K2448003) or reporter RFP (BBa_J04450) expression cassettes.
+
[[File:T--Evry Paris-Saclay--General architecture of the Yarrowia lipolytica Type IIS RFC.png|900px|thumb|left|Figure 1. General architecture of the ''Yarrowia lipolytica'' Type IIS RFC[1000]-compatible Loop assembly platform.]]
−
 
+
−
[[File:T--Evry Paris-Saclay--General architecture of the Yarrowia lipolytica Type IIS RFC.png|900px|thumb|left|Figure 1. General architecture of the Yarrowia lipolytica Type IIS RFC[10]-compatible Loop assembly platform. ]]
+
  
 
The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1, see Figure 2 for more details). A total of 50 combinations are theoretically possible and some relevant examples are listed in Table 1.
 
The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1, see Figure 2 for more details). A total of 50 combinations are theoretically possible and some relevant examples are listed in Table 1.
−
 
  
 
[[File:T--Evry Paris-Saclay--Loop-Sites.png|300px|thumb|center| Figure 2. BsaI and SapI restriction sites (adapted from [8])]]
 
[[File:T--Evry Paris-Saclay--Loop-Sites.png|300px|thumb|center| Figure 2. BsaI and SapI restriction sites (adapted from [8])]]
  
−
==tableau 1 à insérer==
+
{| class="wikitable"
 +
!colspan="4"|Table 1. Different possible Loop Type IIS cloning sites.
 +
|-
 +
|style="width: 20%"| Part name
 +
|Sequence
 +
|
 +
|style="width: 20%"|Part number
 +
|-
 +
|Loop Alpha-A
 +
|GCTCTTCAATGAGGAGTGAGACC
 +
|[[File:T--Evry Paris-Saclay--Loop Alpha-A.png|100px|]]
 +
|[[Part:BBa_K2983010|BBa_K2983010]]
 +
|-
 +
|Loop F-Beta
 +
|GGTCTCACGCTAGCATGAAGAGC
 +
|[[File:T--Evry Paris-Saclay--Loop F-Beta.png|100px|]]
 +
|[[Part:BBa_K2983011|BBa_K2983011]]
 +
|-
 +
|Loop Beta-A
 +
|GCTCTTCAGCAAGGAGTGAGACC
 +
|[[File:T--Evry Paris-Saclay--Loop Beta-A.png|100px|]]
 +
|[[Part:BBa_K2983012|BBa_K2983012]]
 +
|-
 +
|Loop F-Gamma
 +
|GGTCTCACGCTATACTGAAGAGC
 +
|[[File:T--Evry Paris-Saclay--Loop F-Gamma.png|100px|]]
 +
|[[Part:BBa_K2983013|BBa_K2983013]]
 +
|-
 +
|Loop Gamma-A
 +
|GCTCTTCATACAGGAGTGAGACC
 +
|[[File:T--Evry Paris-Saclay--Loop Gamma-A.png|100px|]]
 +
|[[Part:BBa_K2983014|BBa_K2983014]]
 +
|-
 +
|Loop F-Epsilon
 +
|GGTCTCACGCTACAGTGAAGAGC
 +
|[[File:T--Evry Paris-Saclay--Loop F-Epsilon.png|100px|]]
 +
|[[Part:BBa_K2983015|BBa_K2983015]]
 +
|-
 +
|Loop Epsilon-A
 +
|GCTCTTCACAGAGGAGTGAGACC
 +
|[[File:T--Evry Paris-Saclay--Loop Epsilon-A.png|100px|]]
 +
|[[Part:BBa_K2983016|BBa_K2983016]]
 +
|-
 +
|Loop F-Omega
 +
|GGTCTCACGCTAGGTTGAAGAGC
 +
|[[File:T--Evry Paris-Saclay--Loop F-Omega.png|100px|]]
 +
|[[Part:BBa_K2983017|BBa_K2983017]]
 +
|-
 +
|Loop A-alpha
 +
|GGTCTCAGGAGAATGTGAAGAGC
 +
|[[File:T--Evry Paris-Saclay--Loop A-Alpha.png|100px|]]
 +
|[[Part:BBa_K2983018|BBa_K2983018]]
 +
|-
 +
|Loop Omega-B
 +
|GCTCTTCAGGTATACTTGAGACC
 +
|[[File:T--Evry Paris-Saclay--Loop Omega-B.png|100px|]]
 +
|[[Part:BBa_K2983019|BBa_K2983019]]
 +
|-
 +
|Loop B-Alpha
 +
|GGTCTCATACTAATGTGAAGAGC
 +
|[[File:T--Evry Paris-Saclay--Loop B-Alpha.png|100px|]]
 +
|[[Part:BBa_K2983020|BBa_K2983020]]
 +
|-
 +
|Loop Omega-C
 +
|GCTCTTCAGGTAAATGTGAGACC
 +
|[[File:T--Evry Paris-Saclay--Loop Omega-C.png|100px|]]
 +
|[[Part:BBa_K2983021|BBa_K2983021]]
 +
|-
 +
|Loop C-Alpha
 +
|GGTCTCAAATGAATGTGAAGAGC
 +
|[[File:T--Evry Paris-Saclay--Loop C-Alpha.png|100px|]]
 +
|[[Part:BBa_K2983022|BBa_K2983022]]
 +
|-
 +
|Loop Omega-E
 +
|GCTCTTCAGGTAGCTTTGAGACC
 +
|[[File:T--Evry Paris-Saclay--Loop Omega-E.png|100px|]]
 +
|[[Part:BBa_K2983023|BBa_K2983023]]
 +
|-
 +
|Loop E-Alpha
 +
|GGTCTCAGCTTAATGTGAAGAGC
 +
|[[File:T--Evry Paris-Saclay--Loop E-Alpha.png|100px|]]
 +
|[[Part:BBa_K2983024|BBa_K2983024]]
 +
|-
 +
|Loop Omega-F
 +
|GCTCTTCAGGTACGCTTGAGACC
 +
|[[File:T--Evry Paris-Saclay--Loop Omega-F.png|100px|]]
 +
|[[Part:BBa_K2983025|BBa_K2983025]]
 +
|}
  
−
By an ingenious combination of the two Loop sites, Pollak et al. [8] developed a set of vectors that allow assembly of individual parts: Promoters, 5’UTR, CDS, and Terminators (Level 0 parts) into Transcriptional units (Level 1 or Odd Level parts) and further on into Multi-Transcriptional units (Level 2 or Even Level parts) and even Multi-Multi-Transcriptional units (Level 3 or Odd Level parts).
 
  
−
Based on the general architecture of our Yarrowia lipolytica Loop assembly platform (Figure 1), we designed the pOdd-like (Table 3) and pEven-like plasmids (Table 4) that allow the same modularity for the assembly of complex genetic circuits and further are able to integrate into the oleaginous yeast genome.
+
By an ingenious combination of the two Loop sites, Pollak ''et al.'' [8] developed a set of vectors that allow assembly of individual parts: Promoters, 5’UTR, CDS, and Terminators (Level 0 parts) into Transcriptional units (Level 1 or Odd Level parts) and further on into Multi-Transcriptional units (Level 2 or Even Level parts) and even Multi-Multi-Transcriptional units (Level 3 or Odd Level parts).
  
−
==tableau 2 à insérer==
+
Based on the general architecture of our ''Yarrowia lipolytica'' Loop assembly platform (Figure 1), we designed the YL-pOdd (Table 3) and YL-pEven plasmids (Table 4) that allow the same modularity for the assembly of complex genetic circuits and further are able to integrate into the oleaginous yeast genome.
−
==tableau 3 à insérer==
+
  
−
In addition, we expand the initial panel of combinations of two Loop sites described by Pollak et al. [8] to allow assembly into Multi-Transcriptional units composed of not just 4 (as done in [8]) but also of 2 or 3 genes at the Even Level (Table 4).
+
{| class="wikitable"
 +
!colspan="3"|Table 2. ''Yarrowia lipolytica'' Loop assembly plasmids YL-pOdd.
 +
|-
 +
|  style="width: 30%"|  Part name
 +
|      Loop sites
 +
| style="width: 30%"|    Part number
 +
|-
 +
|      YL-pOdd1
 +
|      Loop Alpha-A & Loop F-Beta
 +
|      [[Part:BBa_K2983030|BBa_K2983030]]
 +
|-
 +
|      YL-pOdd2
 +
|      Loop Beta-A & Loop F-Gamma
 +
|      [[Part:BBa_K2983031|BBa_K2983031]]
 +
|-
 +
|      YL-pOdd3
 +
|      Loop Gamma-A & Loop F-Epsilon
 +
|      [[Part:BBa_K2983032|BBa_K2983032]]
 +
|-
 +
|      YL-pOdd4
 +
|      Loop Epsilon-A & Loop F-Omega
 +
|      [[Part:BBa_K2983033|BBa_K2983033]]
 +
|}
  
−
==tableau 4 à insérer==
+
{| class="wikitable"
 +
!colspan="3"|Table 3. ''Yarrowia lipolytica'' Loop assembly plasmids YL-pEven that allow assembly of 4 genes Multi-Transcriptional units.
 +
|-
 +
|  style="width: 30%"|  Part name
 +
|      Loop sites
 +
| style="width: 30%"|    Part number
 +
|-
 +
|YL-pEven1
 +
|    Loop A-Alpha & Loop Omega-B
 +
|      [[Part:BBa_K2983036|BBa_K2983036]]
 +
|-
 +
|  YL-pEven2   
 +
|  Loop B-Alpha & Loop Omega-C
 +
|      [[Part:BBa_K2983037|BBa_K2983037]]
 +
|-
 +
|YL-pEven3     
 +
|Loop C-Alpha & Loop Omega-E     
 +
|      [[Part:BBa_K2983038|BBa_K2983038]]     
 +
|-
 +
| YL-pEven4   
 +
| Loop E-Alpha & Loop Omega-F   
 +
|      [[Part:BBa_K2983039|BBa_K2983039]]   
 +
|}
  
−
===The Loop assembly technique===
 
  
−
The empty pOdd-like backbones (Table 2) allow the insertion of one combination of a Promoter, a 5’UTR, a CDS and a Terminator in order to form a Transcriptional unit (Level 1 / Odd level). The assembly is made by Golden Gate using BsaI as restriction enzyme, the acceptor pOdd-like plasmid as backbone, and the 4 different individual parts flanked by BsaI sites with compatible cutting sites from the Level 0 plasmid set as inserts (Figure 3). However, in eukaryotes the Promoter and the 5’UTR are often not clearly differentiated (since the boundary between the Promoter and the 5’UTR is not precise). Therefore, in this case, the Level 1 assembly is performed with only 3 fragments. The choice of pOdd-like backbone to be used is dictated by the position of the gene in the multi-transcriptional unit at Level 2 (Even level):
+
In addition, we expand the initial panel of combinations of two Loop sites described by Pollak ''et al.'' [8] to allow assembly into Multi-Transcriptional units composed of not just 4 (as done in [8]) but also of 2 or 3 genes at the Even Level (Table 4).
  
−
pOdd1: for the assembly of Transcriptional units that will be in Position 1 at the Even Level
 
  
−
pOdd2: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 3 or 4 genes
+
{| class="wikitable"
 +
!colspan="3"|Table 4. ''Yarrowia lipolytica'' Loop assembly plasmids YL-pEven that allow assembly of 4 genes Multi-Transcriptional units.
 +
|-
 +
|  style="width: 30%"|  Part name
 +
|      Loop sites
 +
| style="width: 30%"|    Part number
 +
|-
 +
|YL-pOdd5
 +
|    Loop Beta-A & Loop F-Omega
 +
|      [[Part:BBa_K2983034|BBa_K2983034]]
 +
|-
 +
|  YL-pOdd6 
 +
|  Loop Gamma-A & Loop F-Omega  
 +
|      [[Part:BBa_K2983035|BBa_K2983035]]  
 +
|}
  
−
pOdd3: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 4 genes
+
====The Loop assembly technique====
  
−
Odd4: for the assembly of Transcriptional units that will be in Position 4 at the Even Level Multi-Transcriptional units composed of 4 genes
+
The empty YL-pOdd backbones (Table 2) allow the insertion of one combination of a Promoter, a 5’UTR, a CDS and a Terminator in order to form a Transcriptional unit (Level 1 / Odd level). The assembly is made by Golden Gate using BsaI as restriction enzyme, the acceptor YL-pOdd plasmid as backbone, and the 4 different individual parts flanked by BsaI sites with compatible cutting sites from the Level 0 plasmid set as inserts (Figure 3). However, in eukaryotes the Promoter and the 5’UTR are often not clearly differentiated (since the boundary between the Promoter and the 5’UTR is not precise). Therefore, in this case, the Level 1 assembly is performed with only 3 fragments. The choice of YL-pOdd backbone to be used is dictated by the position of the gene in the multi-transcriptional unit at Level 2 (Even level):
  
−
pOdd5: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 2 genes
+
* pOdd1: for the assembly of Transcriptional units that will be in Position 1 at the Even Level
  
−
pOdd6: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 3 genes
+
* pOdd2: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 3 or 4 genes
  
−
[[File:T--Evry Paris-Saclay--Assembly of Level 1 (Odd level).png|600px|thumb|center|Figure 3. Assembly of Level 1 (Odd level) Transcriptional units using BsaI (adapted from [8]).]]
+
* pOdd3: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 4 genes
  
 +
* pOdd4: for the assembly of Transcriptional units that will be in Position 4 at the Even Level Multi-Transcriptional units composed of 4 genes
  
−
The Level 1 Transcriptional units can be assembled into Multi-Transcriptional units (Level 2 or Even Level parts) by Golden Gate using SapI as restriction enzyme (Figure 4). The choice of pOdd-like backbone to be used is dictated by the number of Level 1 Transcriptional units to be assembled and the position in the Multi-multi-transcriptional unit at Level 3 (Odd level).
+
* pOdd5: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 2 genes
  
−
[[File:T--Evry Paris-Saclay--Assembly of Level 2 (Even level).png|600px|thumb|center|Figure 4. Assembly of Level 2 (Even level) Transcriptional units using SapI (adapted from [8]).]]
+
* pOdd6: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 3 genes
  
−
===Conclusions===
+
[[File:T--Evry Paris-Saclay--Assembly of Level 1 (Odd level).png|600px|thumb|center|Figure 3. Assembly of Level 1 (Odd level) Transcriptional units using BsaI (adapted from [8]).]]
  
−
We have designed a Loop assembly system for the oleaginous yeast Yarrowia lipolytica that makes fast and efficient cloning possible by Golden Gate. It offers modularity for assembling complex genetic circuits and their subsequent transfer and integration into the Yarrowia lipolytica genome. Using the YL-pOdd1 plasmid, we were able to derive several Level 1 transcriptional units that we characterized in Yarrowia lipolytica (the details are available on dedicated pages of this wiki: Promoters & Fluorescent Proteins & Bioproduction). Moreover, different other Yarrowia lipolytica genome integration sequences and auxotrophic selection markers are known and can be used to further expand this Loop assembly system. This platform facilitates future cloning of genetic constructs for Yarrowia lipolytica and makes it more accessible to the scientific community in general, and the iGEM community in particular.
 
  
−
===References===
+
The Level 1 Transcriptional units can be assembled into Multi-Transcriptional units (Level 2 or Even Level parts) by Golden Gate using SapI as restriction enzyme (Figure 4). The choice of YL-pOdd backbone to be used is dictated by the number of Level 1 Transcriptional units to be assembled and the position in the Multi-multi-transcriptional unit at Level 3 (Odd level).
  
−
[1]Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS One (2008) 3, e3647.
+
[[File:T--Evry Paris-Saclay--Assembly of Level 2 (Even level).png|600px|thumb|center|Figure 4. Assembly of Level 2 (Even level) Transcriptional units using SapI (adapted from [8]).]]
  
−
[2]Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One (2009) 4, e5553.
 
  
−
[3]Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized assembly of multigene constructs. PLoS ONE (2011) 6, e16765.
+
===References===
  
−
[4]Sarrion-Perdigones A, Vazquez-Vilar M, Palacı J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiology (2013) 162, 1618–1631.
+
[1] Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS One (2008) 3, e3647.
−
[5]Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. EcoFlex: a multifunctional MoClo kit for E. coli synthetic biology. ACS Synth Biol (2016) 5, 1059-1069.
+
  
−
[6]Celińska E, Ledesma-Amaro R, Larroude M, Rossignol T, Pauthenier C, Nicaud JM. Golden Gate Assembly system dedicated to complex pathway manipulation in Yarrowia lipolytica. Microb Biotechnol (2017) 10, 450-455.
+
[2] Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One (2009) 4, e5553.
  
−
[7]Larroude M, Park YK, Soudier P, Kubiak M, Nicaud JM, Rossignol T. A modular Golden Gate toolkit for Yarrowia lipolytica synthetic biology. Microb Biotechnol (2019) in press.
+
[3] Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized assembly of multigene constructs. PLoS ONE (2011) 6, e16765.
  
−
[8]Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.
+
[4] Sarrion-Perdigones A, Vazquez-Vilar M, Palacı J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiology (2013) 162, 1618–1631.
  
−
[9]Pignède G, Wang HJ, Fudalej F, Seman M, Gaillardin C, Nicaud JM. Autocloning and amplification of LIP2 in Yarrowia lipolytica. Appl Environ Microbiol (2000) 66, 3283-3289.  
+
[5] Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. EcoFlex: a multifunctional MoClo kit for ''E. coli'' synthetic biology. ACS Synth Biol (2016) 5, 1059-1069.
  
−
[10] Barth G, Gaillardin C. Yarrowia lipolytica. In: Wolf K (ed) Non conventional yeasts in biotechnology. Springer, Berlin (1996) 1, 314-388.
+
[6] Celińska E, Ledesma-Amaro R, Larroude M, Rossignol T, Pauthenier C, Nicaud JM. Golden Gate Assembly system dedicated to complex pathway manipulation in ''Yarrowia lipolytica''. Microb Biotechnol (2017) 10, 450-455.
  
−
[11]Lazar Z, Rossignol T, Verbeke J, Crutz-Le Coq AM, Nicaud JM, Robak M. Optimized invertase expression and secretion cassette for improving Yarrowia lipolytica growth on sucrose for industrial applications. J Ind Microbiol Biotechnol (2013) 40, 1273-83.
+
[7] Larroude M, Park YK, Soudier P, Kubiak M, Nicaud JM, Rossignol T. A modular Golden Gate toolkit for ''Yarrowia lipolytica'' synthetic biology. Microb Biotechnol (2019) 12, 1249– 1259.
  
−
[12]Bordes F, Fudalej F, Dossat V, Nicaud JM, Marty A. A new recombinant protein expression system for high-throughput screening in the yeast Yarrowia lipolytica. J Microbiol Methods (2007) 70, 493-502.
+
[8] Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.
  
−
[13]Fickers P, Le Dall MT, Gaillardin C, Thonart P, Nicaud JM. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J Microbiol Methods (2003) 55, 727-737.
+
[9] Pignède G, Wang HJ, Fudalej F, Seman M, Gaillardin C, Nicaud JM. Autocloning and amplification of ''LIP2'' in ''Yarrowia lipolytica''. Appl Environ Microbiol (2000) 66, 3283-3289.  
  
−
[14]Xuan JW, Fournier P, Declerck N, Chasles M, Gaillardin C. Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica. Mol Cell Biol (1990) 10, 4795-4806.
+
[10] Barth G, Gaillardin C. ''Yarrowia lipolytica''. In: Wolf K (ed) Non conventional yeasts in biotechnology. Springer, Berlin (1996) 1, 314-388.
  
 +
[11] Lazar Z, Rossignol T, Verbeke J, Crutz-Le Coq AM, Nicaud JM, Robak M. Optimized invertase expression and secretion cassette for improving ''Yarrowia lipolytica'' growth on sucrose for industrial applications. J Ind Microbiol Biotechnol (2013) 40, 1273-83.
  
 +
[12] Bordes F, Fudalej F, Dossat V, Nicaud JM, Marty A. A new recombinant protein expression system for high-throughput screening in the yeast ''Yarrowia lipolytica''. J Microbiol Methods (2007) 70, 493-502.
  
 +
[13] Fickers P, Le Dall MT, Gaillardin C, Thonart P, Nicaud JM. New disruption cassettes for rapid gene disruption and marker rescue in the yeast ''Yarrowia lipolytica''. J Microbiol Methods (2003) 55, 727-737.
  
 +
[14] Xuan JW, Fournier P, Declerck N, Chasles M, Gaillardin C. Overlapping reading frames at the ''LYS5'' locus in the yeast ''Yarrowia lipolytica''. Mol Cell Biol (1990) 10, 4795-4806.
  
  
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->

Latest revision as of 17:33, 21 October 2019


YL-pOdd1

YL-pOdd1 belongs to a collection of parts that compose the Loop assembly system dedicated to the oleaginous yeast Yarrowia lipolytica (see full description bellow). This system makes fast and efficient cloning possible by Golden Gate. It offers modularity for assembling complex genetic circuits and their subsequent transfer and integration into the Yarrowia lipolytica genome.

YL-pOdd1 presents 2 loop sites: Loop Alpha-A (BBa_K2983010) & Loop F-Beta (BBa_K2983011) and thus allows assembly of transcriptional units that will be in Position 1 at the Even Level.

This part works as expected: we successfully used it to build several expression cassettes (BBa_K2983170, BBa_K2983171, BBa_K2983172, BBa_K2983173, BBa_K2983174, BBa_K2983175, BBa_K2983176, BBa_K2983177, BBa_K2983178, BBa_K2983181, BBa_K2983182) that we subsequently integrated in the genome of Yarrowia lipolytica ura3-302 strains and characterised their function.

We also used transformed directly this part in Yarrowia lipolytica and build negative controls for our experiments.

Usage and Biology

Overview

Golden Gate [1, 2] is a powerful molecular biology technique that allows scarless assembly of a large number of DNA fragments. It makes use of type IIS restriction enzymes, such as BsaI, BsmBI, BbsI, SapI, etc., that have the peculiarity of having a recognition site outside their cutting site. This property gives several advantages during cloning:

  • It allows scarless assembly: the cutting sites can be designed so that upon digestion and ligation, the final construct has only the desired sequence without the recognition sites.
  • It allows assembly of a large number of fragments in a defined order: the cutting sites can be diverse and generate several overhangs after digestion that can be ligated easily and specifically, based on complementarity.
  • It allows one pot digestion and ligation: the ligation is irreversible and the final DNA molecule will persist because there is no possibility of recreating the restriction sites. Thus, during the reaction, the final construct continues to accumulate, which increases the overall cloning efficiency.

Golden Gate cloning allows great freedom in design and can employed for building custom made DNA molecules. For these reasons it was adopted by the scientific community who recognised its potential even for developing standardized and modular cloning. Thus, several Golden Gate based tool kits were constructed both for prokaryotes and eukaryotes [3-7 for example]. The recently published Loop assembly system [8] brings Golden Gate cloning to a higher level of creativity and modularity as it allows recursive assembly of DNA fragments.

A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica

The general architecture of the Yarrowia lipolytica Loop assembly platform is depicted in Figure 1. It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the following features:

  • Two Zeta sequences, Zeta Up (BBa_K2983000) and Zeta Down (BBa_K2983001), are flanking the platform. Zeta sequences [9] allow random integrations in Yarrowia lipolytica Po1d strain JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which has the zeta platform at the ura3-302 locus or JMY1212 [12] which has the zeta platform at the leu2-270 locus.
  • The URA3 auxotrophic selection marker [13] (BBa_K2983005) which is composed of the URA3 promoter (BBa_K2983002), URA3 gene (BBa_K2983003) and the URA3 terminator (BBa_K2983004). The URA3 gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23) that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells are able to grow only if uracil or uridine is supplemented in the media. The Yarrowia lipolytica Loop assembly platform having this auxotrophic selection marker needs to be used in Δura strains.
  • Two traditional cloning sites (BamHI and HindIII) are flanking the URA3 auxotrophic selection marker to allow, if needed, changing it to other selection markers like LEU2 [13], LYS5 [14] or HygR [13].
  • The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information) and two SfiI sites in between to allow, if needed, the insertion of E. coli cloning selection markers like LacZalpha (BBa_K2448003) or reporter RFP (BBa_J04450) expression cassettes.
Figure 1. General architecture of the Yarrowia lipolytica Type IIS RFC[1000]-compatible Loop assembly platform.

The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1, see Figure 2 for more details). A total of 50 combinations are theoretically possible and some relevant examples are listed in Table 1.

Figure 2. BsaI and SapI restriction sites (adapted from [8])
Table 1. Different possible Loop Type IIS cloning sites.
Part name Sequence Part number
Loop Alpha-A GCTCTTCAATGAGGAGTGAGACC T--Evry Paris-Saclay--Loop Alpha-A.png BBa_K2983010
Loop F-Beta GGTCTCACGCTAGCATGAAGAGC T--Evry Paris-Saclay--Loop F-Beta.png BBa_K2983011
Loop Beta-A GCTCTTCAGCAAGGAGTGAGACC T--Evry Paris-Saclay--Loop Beta-A.png BBa_K2983012
Loop F-Gamma GGTCTCACGCTATACTGAAGAGC T--Evry Paris-Saclay--Loop F-Gamma.png BBa_K2983013
Loop Gamma-A GCTCTTCATACAGGAGTGAGACC T--Evry Paris-Saclay--Loop Gamma-A.png BBa_K2983014
Loop F-Epsilon GGTCTCACGCTACAGTGAAGAGC T--Evry Paris-Saclay--Loop F-Epsilon.png BBa_K2983015
Loop Epsilon-A GCTCTTCACAGAGGAGTGAGACC T--Evry Paris-Saclay--Loop Epsilon-A.png BBa_K2983016
Loop F-Omega GGTCTCACGCTAGGTTGAAGAGC T--Evry Paris-Saclay--Loop F-Omega.png BBa_K2983017
Loop A-alpha GGTCTCAGGAGAATGTGAAGAGC T--Evry Paris-Saclay--Loop A-Alpha.png BBa_K2983018
Loop Omega-B GCTCTTCAGGTATACTTGAGACC T--Evry Paris-Saclay--Loop Omega-B.png BBa_K2983019
Loop B-Alpha GGTCTCATACTAATGTGAAGAGC T--Evry Paris-Saclay--Loop B-Alpha.png BBa_K2983020
Loop Omega-C GCTCTTCAGGTAAATGTGAGACC T--Evry Paris-Saclay--Loop Omega-C.png BBa_K2983021
Loop C-Alpha GGTCTCAAATGAATGTGAAGAGC T--Evry Paris-Saclay--Loop C-Alpha.png BBa_K2983022
Loop Omega-E GCTCTTCAGGTAGCTTTGAGACC T--Evry Paris-Saclay--Loop Omega-E.png BBa_K2983023
Loop E-Alpha GGTCTCAGCTTAATGTGAAGAGC T--Evry Paris-Saclay--Loop E-Alpha.png BBa_K2983024
Loop Omega-F GCTCTTCAGGTACGCTTGAGACC T--Evry Paris-Saclay--Loop Omega-F.png BBa_K2983025


By an ingenious combination of the two Loop sites, Pollak et al. [8] developed a set of vectors that allow assembly of individual parts: Promoters, 5’UTR, CDS, and Terminators (Level 0 parts) into Transcriptional units (Level 1 or Odd Level parts) and further on into Multi-Transcriptional units (Level 2 or Even Level parts) and even Multi-Multi-Transcriptional units (Level 3 or Odd Level parts).

Based on the general architecture of our Yarrowia lipolytica Loop assembly platform (Figure 1), we designed the YL-pOdd (Table 3) and YL-pEven plasmids (Table 4) that allow the same modularity for the assembly of complex genetic circuits and further are able to integrate into the oleaginous yeast genome.

Table 2. Yarrowia lipolytica Loop assembly plasmids YL-pOdd.
Part name Loop sites Part number
YL-pOdd1 Loop Alpha-A & Loop F-Beta BBa_K2983030
YL-pOdd2 Loop Beta-A & Loop F-Gamma BBa_K2983031
YL-pOdd3 Loop Gamma-A & Loop F-Epsilon BBa_K2983032
YL-pOdd4 Loop Epsilon-A & Loop F-Omega BBa_K2983033
Table 3. Yarrowia lipolytica Loop assembly plasmids YL-pEven that allow assembly of 4 genes Multi-Transcriptional units.
Part name Loop sites Part number
YL-pEven1 Loop A-Alpha & Loop Omega-B BBa_K2983036
YL-pEven2 Loop B-Alpha & Loop Omega-C BBa_K2983037
YL-pEven3 Loop C-Alpha & Loop Omega-E BBa_K2983038
YL-pEven4 Loop E-Alpha & Loop Omega-F BBa_K2983039


In addition, we expand the initial panel of combinations of two Loop sites described by Pollak et al. [8] to allow assembly into Multi-Transcriptional units composed of not just 4 (as done in [8]) but also of 2 or 3 genes at the Even Level (Table 4).


Table 4. Yarrowia lipolytica Loop assembly plasmids YL-pEven that allow assembly of 4 genes Multi-Transcriptional units.
Part name Loop sites Part number
YL-pOdd5 Loop Beta-A & Loop F-Omega BBa_K2983034
YL-pOdd6 Loop Gamma-A & Loop F-Omega BBa_K2983035

The Loop assembly technique

The empty YL-pOdd backbones (Table 2) allow the insertion of one combination of a Promoter, a 5’UTR, a CDS and a Terminator in order to form a Transcriptional unit (Level 1 / Odd level). The assembly is made by Golden Gate using BsaI as restriction enzyme, the acceptor YL-pOdd plasmid as backbone, and the 4 different individual parts flanked by BsaI sites with compatible cutting sites from the Level 0 plasmid set as inserts (Figure 3). However, in eukaryotes the Promoter and the 5’UTR are often not clearly differentiated (since the boundary between the Promoter and the 5’UTR is not precise). Therefore, in this case, the Level 1 assembly is performed with only 3 fragments. The choice of YL-pOdd backbone to be used is dictated by the position of the gene in the multi-transcriptional unit at Level 2 (Even level):

  • pOdd1: for the assembly of Transcriptional units that will be in Position 1 at the Even Level
  • pOdd2: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 3 or 4 genes
  • pOdd3: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 4 genes
  • pOdd4: for the assembly of Transcriptional units that will be in Position 4 at the Even Level Multi-Transcriptional units composed of 4 genes
  • pOdd5: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 2 genes
  • pOdd6: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 3 genes
Figure 3. Assembly of Level 1 (Odd level) Transcriptional units using BsaI (adapted from [8]).


The Level 1 Transcriptional units can be assembled into Multi-Transcriptional units (Level 2 or Even Level parts) by Golden Gate using SapI as restriction enzyme (Figure 4). The choice of YL-pOdd backbone to be used is dictated by the number of Level 1 Transcriptional units to be assembled and the position in the Multi-multi-transcriptional unit at Level 3 (Odd level).

Figure 4. Assembly of Level 2 (Even level) Transcriptional units using SapI (adapted from [8]).


References

[1] Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS One (2008) 3, e3647.

[2] Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One (2009) 4, e5553.

[3] Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized assembly of multigene constructs. PLoS ONE (2011) 6, e16765.

[4] Sarrion-Perdigones A, Vazquez-Vilar M, Palacı J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiology (2013) 162, 1618–1631.

[5] Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. EcoFlex: a multifunctional MoClo kit for E. coli synthetic biology. ACS Synth Biol (2016) 5, 1059-1069.

[6] Celińska E, Ledesma-Amaro R, Larroude M, Rossignol T, Pauthenier C, Nicaud JM. Golden Gate Assembly system dedicated to complex pathway manipulation in Yarrowia lipolytica. Microb Biotechnol (2017) 10, 450-455.

[7] Larroude M, Park YK, Soudier P, Kubiak M, Nicaud JM, Rossignol T. A modular Golden Gate toolkit for Yarrowia lipolytica synthetic biology. Microb Biotechnol (2019) 12, 1249– 1259.

[8] Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.

[9] Pignède G, Wang HJ, Fudalej F, Seman M, Gaillardin C, Nicaud JM. Autocloning and amplification of LIP2 in Yarrowia lipolytica. Appl Environ Microbiol (2000) 66, 3283-3289.

[10] Barth G, Gaillardin C. Yarrowia lipolytica. In: Wolf K (ed) Non conventional yeasts in biotechnology. Springer, Berlin (1996) 1, 314-388.

[11] Lazar Z, Rossignol T, Verbeke J, Crutz-Le Coq AM, Nicaud JM, Robak M. Optimized invertase expression and secretion cassette for improving Yarrowia lipolytica growth on sucrose for industrial applications. J Ind Microbiol Biotechnol (2013) 40, 1273-83.

[12] Bordes F, Fudalej F, Dossat V, Nicaud JM, Marty A. A new recombinant protein expression system for high-throughput screening in the yeast Yarrowia lipolytica. J Microbiol Methods (2007) 70, 493-502.

[13] Fickers P, Le Dall MT, Gaillardin C, Thonart P, Nicaud JM. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J Microbiol Methods (2003) 55, 727-737.

[14] Xuan JW, Fournier P, Declerck N, Chasles M, Gaillardin C. Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica. Mol Cell Biol (1990) 10, 4795-4806.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 1579
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 304
    Illegal XhoI site found at 1281
    Illegal XhoI site found at 1314
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1126
    Illegal NgoMIV site found at 1554
    Illegal AgeI site found at 1023
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 1571
    Illegal BsaI.rc site found at 1537
    Illegal SapI site found at 1520
    Illegal SapI.rc site found at 1587